pLenti-myc-GLUT4-mCherry
(Plasmid #64049)

• Purpose: 3rd generation lentiviral transfer plasmid. Reporter for GLUT4 translocation
• Depositing Lab: Weiping Han
• Publication: Lim et al Nat Commun. 2015 Jan 9;6:5951. doi: 10.1038/ncomms6951.

Backbone

• Vector backbone: pLenti-hiko
• Backbone size w/o insert (bp): 9124
• Total vector size (bp): 11604
• Modifications to backbone: pLenti-hiko was digested with NheI + HpaI
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): XL10 Gold
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: GLUT4
• Species: M. musculus (mouse)
• Insert Size (bp): 1530
• Entrez Gene: Slc2a4 (a.k.a. GT2, Glut-4, Glut4, twgy)
• Promoter: Ubiquitin
• Tags / Fusion Proteins:
  • mCherry (C terminal on insert)
  • c-Myc (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: HpaI (not destroyed)
• 5′ sequencing primer: GGCGAGTGTGTTTTGTGAAG

Resource Information

• Supplemental Documents:
  • xDNA file for pLenti-Myc-mGLUT4-mCherry
• Addgene Notes:
  • Addgene Diagnostic Digest
• Articles Citing this Plasmid:
  • 9 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The c-Myc sequence was inserted into the region encoding the 1st exofacial loop of mouse GLUT4 in the background of pmCherry-N1. The fragment of Myc-GLUT4-mCherry was then sub-cloned into pLenti-hiko vector via NheI + HpaI digestion.

Discrepancies between the Addgene QC sequence and the full sequence are not of functional concern.

Please cite the following article:
Lim, C.-Y. et al. Tropomodulin3 is a novel Akt2 effector regulating insulin-stimulated GLUT4 exocytosis through cortical actin remodeling. Nat Commun 6, 5951 (2015).