Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

PMXS-SLC2A3
(Plasmid #72877)

Full plasmid sequence is not available for this item.

Loading...

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 72877 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pMXs-IRES-blasticidin
  • Backbone size w/o insert (bp) 5639
  • Total vector size (bp) 7130
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    SLC2A3
  • Alt name
    GLUT3
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1491
  • GenBank ID
    NM_006931.2
  • Entrez Gene
    SLC2A3 (a.k.a. GLUT3)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamH1 (unknown if destroyed)
  • 3′ cloning site EcoR1 (unknown if destroyed)
  • 5′ sequencing primer pLXSN 5' CCCTTGAACCTCCTCGTTCGACC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The retroviral SLC2A3 vector was generated by cloning into the BamHI and EcoRI sites of the pMXS-ires-blast vector a cDNA insert generated by PCR from a cDNA from Open Biosystems (cat # MHS1010-7429646) using the primers below, followed by standard cloning techniques.SLC2A3 F: GCA TGG ATC CAC CAT GGG CAC ACA GAA GGT CAC
SLC2A3 R: GCA TCA ATT GTT AGA CAT TGG TGG TGG TCT CC

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PMXS-SLC2A3 was a gift from David Sabatini (Addgene plasmid # 72877 ; http://n2t.net/addgene:72877 ; RRID:Addgene_72877)
  • For your References section:

    Metabolic determinants of cancer cell sensitivity to glucose limitation and biguanides. Birsoy K, Possemato R, Lorbeer FK, Bayraktar EC, Thiru P, Yucel B, Wang T, Chen WW, Clish CB, Sabatini DM. Nature. 2014 Apr 3;508(7494):108-12. doi: 10.1038/nature13110. Epub 2014 Mar 16. 10.1038/nature13110 PubMed 24670634