We narrowed to 562 results for: PA-GFP
-
Plasmid#185307PurposeFor the mammalian expression of the human protein ApoE4_47-300 attached to 2xFKBP. The FKBP can be used for inducible dimerization and condensate formationDepositorInsertApoE4_47-300
ExpressionMammalianAvailable sinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
ApoE2_47-300_mCh-2xFKBP (pBS1111)
Plasmid#185306PurposeFor the mammalian expression of the human protein ApoE2_47-300 attached to 2xFKBP. The FKBP can be used for inducible dimerization and condensate formationDepositorInsertApoE2_47-300
ExpressionMammalianAvailable sinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ai14-luc
Plasmid#87118PurposeAAV backbone plasmid including luc-pA knock-in donor and Ai14gRNA for HITIDepositorInsertU6-Ai14sgRNA-Luciferase-nEF-GFPKASH-hGHpA
UseAAV, CRISPR, and LuciferaseAvailable sinceMarch 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pA-RFP-rG2
Plasmid#188969PurposeIPTG inducible mCherry with sgRNADepositorInsertsmCherry
sgRNA: agtccatgtaatcagcgtctactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable sinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
HLH Clock Pas 1-401 VenN
Plasmid#47353PurposeClock fragment cloned and tagged with VenNDepositorAvailable sinceSept. 4, 2013AvailabilityAcademic Institutions and Nonprofits only -
HLH Bmal Pas 1-465-VenC
Plasmid#47364PurposeBmal fragment cloned with Venus tag and used for BiFCDepositorAvailable sinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
HLH Bmal Pas 1-465-VenC I317D
Plasmid#47367PurposeBmal fragment cloned with Venus tag used for mutationDepositorInsertBMAL (Bmal1 Mouse)
TagsVenus aa 156-239ExpressionMammalianMutationaa 1-465, I317DPromoterCMVAvailable sinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
HLH Clock Pas 1-401 VenN L74E
Plasmid#47355PurposeClock fragment mutatation tagged with VenN used for BiFCDepositorInsertClock (Clock Mouse)
TagsVenus aa 1-155ExpressionMammalianMutationaa 1-401, L74EPromoterCMVAvailable sinceSept. 4, 2013AvailabilityAcademic Institutions and Nonprofits only -
HLH Clock Pas 1-401 VenN L113E
Plasmid#47356PurposeClock fragment mutatation tagged with VenN used for BiFCDepositorInsertClock (Clock Mouse)
TagsVenus aa 1-155ExpressionMammalianMutationaa 1-401, L113EPromoterCMVAvailable sinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
HLH Clock Pas 1-401 VenN F122D
Plasmid#47357PurposeClock fragment mutatation tagged with VenN used for BiFCDepositorInsertClock (Clock Mouse)
TagsVenus aa 1-155ExpressionMammalianMutationaa 1-401, F122DPromoterCMVAvailable sinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
HLH Clock Pas 1-401 VenN W284A
Plasmid#47358PurposeClock fragment mutatation tagged with VenN used for BiFCDepositorInsertClock (Clock Mouse)
TagsVenus aa 1-155ExpressionMammalianMutationaa 1-401, W284APromoterCMVAvailable sinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
HLH Clock Pas 1-401 VenN V315R
Plasmid#47359PurposeClock fragment mutatation tagged with VenN used for BiFCDepositorInsertClock (Clock Mouse)
TagsVenus aa 1-155ExpressionMammalianMutationaa 1-401, V315RPromoterCMVAvailable sinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
HLH Clock Pas 1-401 VenN L57E/L113E/W284A
Plasmid#47360PurposeClock fragment mutatation tagged with VenN used for BiFCDepositorInsertClock (Clock Mouse)
TagsVenus aa 1-155ExpressionMammalianMutationaa 1-401, L57E/L113E/W284APromoterCMVAvailable sinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
HLH Bmal Pas 1-465-VenC L95E
Plasmid#47365PurposeBmal fragment cloned with Venus tag used for mutationDepositorInsertBMAL (Bmal1 Mouse)
TagsVenus aa 156-239ExpressionMammalianMutationaa 1-465, L95EPromoterCMVAvailable sinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
HLH Bmal Pas 1-465-VenC L150E
Plasmid#47366PurposeBmal fragment cloned with Venus tag used for mutationDepositorInsertBMAL (Bmal1 Mouse)
TagsVenus aa 156-239ExpressionMammalianMutationaa 1-465, L150EPromoterCMVAvailable sinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
HLH Bmal Pas 1-465-VenC L95E/L150E/W427A
Plasmid#47372PurposeBmal fragment cloned with Venus tag used for mutationDepositorInsertBMAL (Bmal1 Mouse)
TagsVenus aa 156-239ExpressionMammalianMutationaa 1-465, L95E/L150E/W427APromoterCMVAvailable sinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
HLH Bmal Pas 1-465-VenC L115E
Plasmid#47377PurposeBmal fragment cloned with Venus tag used for mutationDepositorAvailable sinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
HLH Bmal Pas 1-465-VenC F423R
Plasmid#47368PurposeBmal fragment cloned with Venus tag used for mutationDepositorInsertBMAL (Bmal1 Mouse)
TagsVenus aa 156-239ExpressionMammalianMutationaa 1-465, F423RPromoterCMVAvailable sinceSept. 4, 2013AvailabilityAcademic Institutions and Nonprofits only -
HLH Bmal Pas 1-465-VenC W427A
Plasmid#47369PurposeBmal fragment cloned with Venus tag used for mutationDepositorInsertBMAL (Bmal1 Mouse)
TagsVenus aa 156-239ExpressionMammalianMutationaa 1-465, W427APromoterCMVAvailable sinceSept. 4, 2013AvailabilityAcademic Institutions and Nonprofits only -
HLH Bmal Pas 1-465-VenC V435R
Plasmid#47370PurposeBmal fragment cloned with Venus tag used for mutationDepositorInsertBMAL (Bmal1 Mouse)
TagsVenus aa 156-239ExpressionMammalianMutationaa 1-465, V435RPromoterCMVAvailable sinceSept. 4, 2013AvailabilityAcademic Institutions and Nonprofits only