We narrowed to 27,202 results for: c-myc
-
Plasmid#81064PurposeGateway entry vector encoding full length UBR5 Y2402A/K2415A (∆PABC)DepositorInsertUbiquitin protein ligase E3 component N-recognin 5 (UBR5) ∆PABC (UBR5 Human)
UseCloningMutationY2402A and K2415A (bp t7204g, a7205c, t7206c, a72…PromoterN/AAvailable sinceJan. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3-deltaBamHI-human MIZ1
Plasmid#74167PurposeMammalian expression of human MIZ1DepositorAvailable sinceApril 12, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pT2K-CAGGS-U6-sgRNA-M5-U6-sgRNA-M7-U6-sgRNA-M9-IRES-CFP
Plasmid#114729Purpose3 sgRNAs targeting a sequence upstream of the initiator ATG of the cellular Myc geneDepositorInsertsgRNA M5, sgRNA M7, sgRNA M9
UseCRISPRExpressionMammalianAvailable sinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Ad:2CMV_A2R2-N25Ctr
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable sinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
BIRC3A
Plasmid#42378PurposeBacterial expression for structure determination; may not be full ORFDepositorAvailable sinceMarch 18, 2013AvailabilityAcademic Institutions and Nonprofits only -
pQdCas12a.sggfp(C)
Plasmid#236042PurposeThe plasmid pQdCas12a.sggfp(C) expresses the dCas12a endonuclease and the sgRNA (design C) targeting the gfp gene.DepositorInsertquorum sensing cassette luxI, luxR, and the LuxR-dependent promoter pLuxI , dCas12a and sgRNA design (C) of gfp gene
UseCRISPRPromoterquorum sensing promoterAvailable sinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-CRISPR-Puro-sgRPL3-56
Plasmid#208979PurposepcDNA3.1 based plasmid for transient transfection of sgRNA-cas9. Containing sgRNA targeting human RPL3 (GRCh38.p14_Chr22:39312868-39312887), 56 is a number given by www.e-crisp.org.DepositorInsertsgRNA targeting human RPL3 (ENST00000216146) C-terminal, No.56 (RPL3 Human, Synthetic)
UseCRISPRExpressionMammalianPromoterCMV and U6 in tandemAvailable sinceJan. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
PB513B-1/TRE-hHNF1α-hHNF3β-hCEBPα-hCEBPβ-hCEBPγ-EF1α-Puro
Plasmid#199550PurposePiggyBac-based transposon vector plasmid which encodes the expression units of liver-enriched transcription factor genes (hHNF1α-hHNF3β-hCEBPα-hCEBPβ-hCEBP-γ) under control of the TRE/PCMVmin promoterDepositorUsePiggybac transposon vectorExpressionMammalianPromoterTRE+CMVmin promoterAvailable sinceAug. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
NME3
Plasmid#25536PurposeBacterial expression for structure determination; may not be full ORFDepositorAvailable sinceAug. 24, 2010AvailabilityIndustry, Academic Institutions, and Nonprofits -
-
RNF2
Plasmid#25268PurposeBacterial expression for structure determination; may not be full ORFDepositorAvailable sinceAug. 16, 2010AvailabilityIndustry, Academic Institutions, and Nonprofits -
HECW2
Plasmid#32875PurposeBacterial expression for structure determination; may not be full ORFDepositorAvailable sinceJan. 6, 2012AvailabilityIndustry, Academic Institutions, and Nonprofits -
pMXs-ms-Sox3
Plasmid#50779Purposeretroviral expression of mouse Sox3DepositorAvailable sinceFeb. 28, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMXs-ms-Sox7
Plasmid#50780Purposeretroviral expression of mouse Sox7DepositorAvailable sinceFeb. 28, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-PIG-miR-22
Plasmid#64229PurposeExpresses miR-22 in mammalian cellsDepositorAvailable sinceJune 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
GST-N1IC
Plasmid#47612Purposebacterial expression of GST-myc-Notch1 ICDepositorInsertNotch1 intracellular domain (Notch1 Mouse)
TagsGST and mycExpressionBacterialMutationcontains amino acids 1753-2531PromotertacAvailable sinceAug. 28, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMXs-ms-Sox18
Plasmid#50782Purposeretroviral expression of mouse Sox18DepositorAvailable sinceFeb. 28, 2014AvailabilityAcademic Institutions and Nonprofits only -
NanoBRET Assay Vector, CSF1R-HaloTag
Plasmid#238705PurposeExpress CSF1R-HaloTag Fusion Protein in Mammalian Cells under a CMV promoterDepositorHas serviceDNAInsertCSF1R (CSF1R Human)
TagsHaloTag (R)ExpressionMammalianMutationNonePromoterCMVAvailable sinceFeb. 18, 2026AvailabilityIndustry, Academic Institutions, and Nonprofits -
pvPE-V3-Puro
Plasmid#240289PurposeEncodes third generation porcine endogenous retrovirus-derived prime editing (pvPE) system with puromycin resistance gene in to mammalian cells for gene editing.DepositorInsertpvPE-V3-Puro
UseCRISPRTagsSV40 NLSExpressionMammalianPromoterCMVAvailable sinceOct. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
NanoBRET Assay Vector, CSF1R-NanoLuc
Plasmid#238706PurposeExpress CSF1R-NanoLuc Fusion Protein in Mammalian Cells under a CMV promoterDepositorHas serviceDNAInsertCSF1R (CSF1R Human)
TagsNanoLuc (R)ExpressionMammalianMutationNonePromoterCMVAvailable sinceSept. 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits