We narrowed to 15,703 results for: jun
-
Plasmid#202071PurposeBacterial expression of VP1 protein from poliovirus 1 (PV1). Contains N-terminal GST-tag and C-terminal His6-tag.DepositorInsertPV1 VP1 protein with Histag
Tags6xHis-tag and GSTExpressionBacterialPromotertacAvailable sinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-sCAG-GluClβ.CreON
Plasmid#196996PurposeCre recombinase dependent expression of GluClv2.0 beta subunit. GluClβ contains a YFP tag. When co-expressed with GluClv2.0 alpha subunit, agonist (Ivermectin) induces neuronal silencing.DepositorInsertGluClβ -YFP
UseAAV and Cre/LoxTagsYFPPromotershort CAGAvailable sinceJune 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
U6-Slc1a3 sgRNA; EF1a-dCas9-KRAB-GFP
Plasmid#194283PurposeEF1a-dCas9-KRAB-GFP with Slc1a3 sgRNADepositorInsertdCas9-KRAB-GFP
UseCRISPR and LentiviralTagsGFPPromoterEF1aAvailable sinceJune 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
SPDK3860
Plasmid#199245PurposeModified Tobacco rattle virus (TRV) RNA2 vector for editing of Nicotiana benthamiana Phytoene desaturase (PDS) geneDepositorInsertModified TRV RNA2 with PEBV promoter and AtIleu-tRNA mobile RNA sequence
UseT-dna vectorPromoterpPEBVAvailable sinceJune 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL E167D (siRNA resistant)
Plasmid#191013PurposeExpresses EGFP-tagged MASTL with E167D mutation and resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationE167DAvailable sinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLNHA-C1-HsGIGYF2_AE
Plasmid#148550PurposeMammalian Expression of HsGIGYF2DepositorInsertHsGIGYF2 (GIGYF2 Human)
ExpressionMammalianMutationone silent mutation and one deletion of Q1211 com…Available sinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLPB2-SpdCas9-tagRFPt-P2A-tagBFP-PGK-Blasticidin
Plasmid#187945PurposedCas9 fused with tagRFPt, P2A site and tagBFP, expressed under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance under PGK promoter.DepositorInsertSpdCas9-tagRFPt-P2A-tagBFP
UseSynthetic Biology; PiggybacTagsNLS, NLS + HA-tag, P2A, tagBFP, and tagRFPtExpressionMammalianAvailable sinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX601‐MHP1‐miniABEmaxNG‐N2‐(GG)
Plasmid#187067PurposeGp41-1 Split N-terminal half of ABEmaxNGA driven by MHP1 promoter with gRNA targeting mdx4cv nonsense mutationDepositorInsertminiABEmaxNG-Gp41
UseAAV and CRISPRExpressionMammalianPromoterMHP1Available sinceAug. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX601‐MHP1‐ABEmaxC2‐NG‐E53 ogRNA
Plasmid#187068PurposeGp41-1 Split C-terminal half of ABEmaxNGA driven by MHP1 promoter with gRNA targeting mdx4cv nonsense mutationDepositorInsertGp41-ABEmaxC2‐NG
UseAAVExpressionMammalianPromoterMHP1Available sinceAug. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-hPGK-mCherry-SynaptoZip
Plasmid#177317PurposeLentiviral expression of the synaptic activity-marker SynaptoZip fused to mCherry driven by hPGK promoterDepositorAvailable sinceJune 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFRT-DHX36iso2E335A
Plasmid#159588PurposeExpress N-ter FLAG HA tagged DHX36 isoform 2 with E335A mutation in mammalian cellsDepositorAvailable sinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lyn-tdnano-HA
Plasmid#136512PurposeMammalian expression of a tandem dimer of WT SspB (nano), targeted to membrane by Lyn myristoylation sequence, with triple-HA epitope tagDepositorInsertLyn nano nano 3HA
ExpressionMammalianPromoterCMVAvailable sinceMay 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMH015_AAVS1_puro-pA-core-9xTetO-pEF-H2B-mCitrine-core-pRSV-H2B-mCherry
Plasmid#179437PurposeDual fluorescent reporter construct with double core HS4 insulator, upstream TRE (Tetracycline Response Element) recruitment site, arms for integration at AAVS1 locusDepositorInsertcoreHS4-TRE-cit-coreHS4-mch (DC)
ExpressionMammalianPromoterpEF alpha, pRSVAvailable sinceFeb. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMH012_AAVS1_puro-pA-9xTetO-pEF-H2B-mCitrine-core-pRSV-H2B-mCherry
Plasmid#179435PurposeDual fluorescent reporter construct with single core HS4 insulator, upstream TRE (Tetracycline Response Element) recruitment site, arms for integration at AAVS1 locusDepositorInsertTRE-cit-coreHS4-mch (SC)
ExpressionMammalianPromoterpEF alpha, pRSVAvailable sinceFeb. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMH002_phiC31_neo-5xTetO-pEF-H2B-mCitrine-HS4-pRSV-H2B-mCherry
Plasmid#179430PurposeDual fluorescent reporter construct with single HS4 insulator, upstream TRE (Tetracycline Response Element) recruitment site, phiC31 attB for integrationDepositorInsertTRE-cit-HS4-mch (SH)
ExpressionMammalianPromoterpEF alpha, pRSVAvailable sinceFeb. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pIRESneo2 mycBioID-Tollip
Plasmid#178054Purposemyc-BioID fused to human Tollip cloned into the pIRESneo2 plasmid. For generation of stable expressing mammalian cells used for proximity dependent biotin labelling.DepositorAvailable sinceDec. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBS-KS-attB1-2-PT-SA-SD-1-mTagBFP2(11x7)
Plasmid#172065PurposeProtein trap plasmid for inserting mTagBFP2(11x7) into a phase 1 coding intronDepositorInsertmTagBFP2(11x7)
ExpressionInsectAvailable sinceOct. 20, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pBS-KS-attB1-2-PT-SA-SD-1-GFP11
Plasmid#172068PurposeProtein trap plasmid for inserting GFP11 into a phase 1 coding intronDepositorInsertGFP11x7
ExpressionInsectAvailable sinceOct. 20, 2021AvailabilityIndustry, Academic Institutions, and NonprofitsCited by -
pAAV-EF1a-FRT-EBFP-tTAn
Plasmid#172127PurposeExpression of EBFP and tTA-InteinN in Flp recombinase positive cellsDepositorInsertEBFP, tTAn-InteinN
UseAAVPromoterEF1aAvailable sinceSept. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHR LAT-FFF/Zap70 iLID-Drop
Plasmid#171032PurposeLight-induced LAT-Zap70 dimerization and LAT clustering. Zap70 is TagRFP-tagged. LAT has three Tyr-Phe mutations.DepositorAvailable sinceSept. 13, 2021AvailabilityAcademic Institutions and Nonprofits only