We narrowed to 27,307 results for: GFP
-
Plasmid#96860Purposeguanine-agRNA (GFP activation, 18 nt blocker with bulges)DepositorInsertguanine-agRNA (GFP activation, 18 nt blocker with bulges)
ExpressionMammalianAvailable sinceNov. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFP59
Plasmid#247215PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (tDF30ppr) from an E. coli sigma70 promoter. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with tRNA and F30 scaffolds)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterPj23100 (ttgacggctagctcagtcctaggtacagtgctagc)Available sinceMay 29, 2026AvailabilityAcademic Institutions and Nonprofits only -
pQdCas12a.sggfp(B)
Plasmid#236040PurposeThe plasmid pQdCas12a.sggfp(B) expresses the dCas12a endonuclease and the sgRNA (design B) targeting the gfp gene.DepositorInsertquorum sensing cassette luxI, mutated luxR, and the LuxR-dependent promoter pLuxI , dCas12a and sgRNA design (B) of gfp gene
UseCRISPRPromoterquorum sensing promoterAvailable sinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAX2
Plasmid#117398Purposeallelic exchange vector with GFP merodiploid tracker, temperature-sensitive origin of replication, and TetR-controlled kill switchDepositorTypeEmpty backboneUseSynthetic BiologyExpressionBacterialAvailable sinceMarch 20, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSMAL
Plasmid#161785PurposeGateway destination vector with bidirectional CMV-SFFV promoter for high expression of gene of interest and GFP.DepositorTypeEmpty backboneUseLentiviralExpressionMammalianPromoterBidirectional minhCMV and SFFVAvailable sinceDec. 30, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
ZJOM10
Plasmid#133639PurposeIntegration of VPS4-GFP as an additional copy in genome, use auxotrophic marker URA3(Candida albicans). Marker for yeast late endosome.DepositorAvailable sinceFeb. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLVX-RT001-LVB
Plasmid#163381PurposeSecond generation lentiviral vector to express anti-GFP(LaG17) module in the G-baToN systemDepositorInsertLaG17-VEEGFRtm-BFP (LVB)
UseLentiviralTagsBFPExpressionMammalianPromoterEF1AAvailable sinceJan. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
PCR4-Hsp68::mCherry-SI-Hsp68::eGFP-H11
Plasmid#211942Purposedual-enSERT-2.2 vector for site-specific integration of.a two-color enhancer-reporter construct into the H11 locus (separated by a synthetic insulator)DepositorTypeEmpty backboneUseCRISPR and Mouse TargetingExpressionMammalianPromoterHSP68Available sinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSJ1568 (pRS315-NOP1pr-GFP11-mCherry-SCS2TM)
Plasmid#86416PurposeONM/ER split GFP11 reporter with mCherryDepositorInsertNOP1pr-GFP11-mCherry-Scs2TM
TagsGFP11 and mCherryExpressionYeastPromoterNOP1Available sinceFeb. 27, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLTR.gp140/EGFP.Revdelta38/DsRed
Plasmid#115775PurposeHIV splicing reporter allows the assessment of the effect of LRAs on HIV-1 transcription and splicing.DepositorInsertEnvelope fused to EGFP (gp140-EGFP) and non-functional Rev protein fused to DsRed fluorescent protein (Rev-delta38-DsRed).
TagsEGFP; dsReDExpressionMammalianMutationgp140 uncleaved (1190-91aa, KR > TG; truncated…PromoterHIV-1 (LTR)Available sinceOct. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUpstream2Lox
Plasmid#164573PurposeIntegration of 2 LoxN sites in the genome of P. bergheiDepositorInsertsUseCre/LoxPromoterBidirectional PbEF1alpha promoter (PBANKA_1133300…Available sinceMarch 10, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAS_4xMx PylT_GFP 150TAG
Plasmid#140016PurposePlasmid with 4xMxPylT cassette and amber suppression reporter sfGFP 150 TAG stop; for transient transfection or stable piggyBac-mediated integrationDepositorInsertsfGFP
ExpressionMammalianMutation150TAG, K46E (Please see depositor comments below)PromoterEF1Available sinceMay 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEJS476-pHAGE-TO-Nme dCas9 3XGFP-SgRNA/Telomere-All-in-one
Plasmid#85716PurposeExpresses dNmeCas9-3XsfGFP and telomere-targeting Nme sgRNADepositorInsertsNme dCas9
telomere sgRNA
UseCRISPR and LentiviralTags3XsfGFPExpressionMammalianPromoterCMV-TO and U6Available sinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
SBP-GFP-Tac-TC
Plasmid#162506PurposeExpresses GFP tagged partial length Tac (TMD and cytosolic tail) in RUSH vector in mammalian cellsDepositorInsertGFP and SBP tagged partial length Tac (TMD and cytosolic tail) (IL2RA Human)
TagsGFP and SBPExpressionMammalianAvailable sinceJan. 29, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAL750 :: msfGFP
Plasmid#250661PurposeInducible promoter Pxyl expressing msfGFP in haloarcheon Haloferax volcaniiDepositorInsertMonomeric Superfolder Green Fluorescent Protein
UseHaloarchaeal expressionAvailable sinceJan. 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pVEC1
Plasmid#241910PurposePrimary screening of PET hydrolases and enzyme condition screening. TphR-based terephthalate (TPA) biosensorDepositorInserttphR, tphK, sfGFP
UseSynthetic BiologyMutationnoneAvailable sinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSEED-mCherry
Plasmid#219657PurposePermits GoldenGate (BsmBI) assembly of donor plasmids to knock-in mCherry using the SEED/Harvest methodDepositorInsertsfGFP SEED Cassette
Available sinceOct. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pM423
Plasmid#172408PurposeExpresses sfGFP (1-10) and MCP-GFP11DepositorInsertMCP, bipartite sfGFP
UseCRISPR and LentiviralTagssfGFP {1-10}ExpressionMammalianPromoterhPGKAvailable sinceSept. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
EF1α-scFv-p65-HSF1-T2A-EGFP-WPRE-PolyA
Plasmid#107311PurposeEncoding scFv-p65-HSF1 driven by EF1α promoterDepositorInsertEF1α-scFv-p65-HSF1-T2A-EGFP-WPRE-PolyA
UseLentiviralExpressionMammalianAvailable sinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pRK5_TagBFP_P2AT2A_GFP-nb-KS-FtoG
Plasmid#238275PurposeFor overexpression of TagBFP_P2AT2A_GFP-nb-KS-FtoGDepositorInsertTagBFP_P2AT2A_GFP-nb-KS-FtoG
ExpressionMammalianAvailable sinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only