We narrowed to 16,505 results for: grna
-
Plasmid#232886PurposePlasmid expressing Cas9 and gRNA GAAGTAACAAAGGAACCTAG which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pML104-HygMx4-URA3-2
Plasmid#232885PurposePlasmid expressing Cas9 and gRNA TCGTACCACCAAGGAATTAC which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-3
Plasmid#232882PurposePlasmid expressing Cas9 and gRNA AAACCTTTTTACTCCACGCA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-2
Plasmid#232881PurposePlasmid expressing Cas9 and gRNA CCAAGTTCGACAACTGCGTA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ADE13
Plasmid#232887PurposePlasmid expressing Cas9 and gRNA GTAGCAGCAAAAGAAGACAA which targets the ADE13 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#232883PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
KHC065 pBABE pU6 BRD2 K1-2C
Plasmid#231712PurposeKHC065 (pBABE pU6 BRD2 K1-2C), gRNA and cas9D10A mammalian expression vector for CRISPR mediated cutting of BRD2 at the N-terminus, use with KHC064DepositorAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
KHC064 pX335 BRD2 K1-1a
Plasmid#231711PurposeKHC064 (pX335 BRD2 K1-1a), gRNA and cas9D10A mammalian expression vector for CRISPR mediated cutting of BRD2 at the N-terminus, use with KHC065DepositorAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
PX459v3-SpCas9-HF1
Plasmid#178801PurposeHigh-fidelity SpCas9-HF1 with 2A-Puro, and a golden gate cloning backbone for sgRNA. sgRNA scaffold seqeuence has been modified for increased sgRNA expression (v3).DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterCbh (Cas9-2A Puro) and U6 (gRNA)Available SinceAug. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003.gEZH2
Plasmid#220318PurposeExpresses guide RNA for CRISPR/Cas9 knockout of EZH2 for knockout/rescue experiments in mammalian cells.DepositorAvailable SinceJune 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6(gDmap1 v4)-PGK-Puro-BFP
Plasmid#117143PurposeExpress gRNA vs Dmap1DepositorInsertgDmap1 v4 (Dmap1 Synthetic)
UseCRISPR and LentiviralMutationDeleted BbsI site within WPRE, modified BFPPromoterhuman U6 promoter, mouse PGK promoterAvailable SinceApril 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6(gDmap1 v5)-PGK-Puro-BFP
Plasmid#117144PurposeExpress gRNA vs Dmap1DepositorInsertgDmap1 v5 (Dmap1 Synthetic)
UseCRISPR and LentiviralMutationDeleted BbsI site within WPRE, modified BFPPromoterhuman U6 promoter, mouse PGK promoterAvailable SinceApril 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6(gDmap1 v2)-PGK-Puro-BFP
Plasmid#117141PurposeExpress gRNA vs Dmap1DepositorInsertgDmap1 v2 (Dmap1 Synthetic)
UseCRISPR and LentiviralMutationDeleted BbsI site within WPRE, modified BFPPromoterhuman U6 promoter, mouse PGK promoterAvailable SinceApril 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
Adeno FT
Plasmid#101824PurposeAdenovirus for the expression of gRNAs targeting intron 17 of murine Fgfr3 and intron 6 of murine Tacc3DepositorUseAdenoviralTagsFLAG-Cas9PromoterU6 and CBhAvailable SinceNov. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
Adeno BN
Plasmid#101823PurposeAdenovirus for the expression of gRNAs targeting intron 13 of murine Bcan and intron 10 of murine Ntrk1DepositorUseAdenoviralTagsFLAG-Cas9Available SinceNov. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTargetF
Plasmid#62226PurposeConstitutive expression of sgRNA without donor editing template DNADepositorInsertsgRNA
UseCRISPRExpressionBacterialPromoterpij23119Available SinceMarch 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFREE_Zeo
Plasmid#92053PurposeAllows inducible expression of gRNAs and Cas9 for plasmid curing.DepositorInsertsCas9
gRNA array
UseCRISPRPromoterpRhamBAD and ptetAvailable SinceJune 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
PB_p300_core-dCas9-EGFP_hygro
Plasmid#226431PurposePiggyBac transposon vector containing a dox inducible p300 core-dCas9 fusion protein and EGFP reporter. Hygromycin selection markerDepositorInsertsp300 core-dCas9-EGFP fusion protein
rtTA3-IRES-Hygro
UseCRISPR and Synthetic Biology; Piggybac transposonTagsHA tag, P2A-EGFP, and p300 coreExpressionMammalianPromoterDox inducible minimal CMV and UbC PromoterAvailable SinceSept. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFREE_Amp
Plasmid#92051PurposeAllows inducible expression of gRNAs and Cas9 for plasmid curing.DepositorInsertsCas9
gRNA array
UseCRISPRPromoterpRhamBAD and ptetAvailable SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFREE_Cm
Plasmid#92052PurposeAllows inducible expression of gRNAs and Cas9 for plasmid curing.DepositorInsertsCas9
gRNA array
UseCRISPRPromoterpRhamBAD and ptetAvailable SinceAug. 3, 2017AvailabilityAcademic Institutions and Nonprofits only