We narrowed to 9,718 results for: CAG
-
Plasmid#66094Purposeco-expression of Cas9 and a sgRNA targeting 3'end of C.elegans K08F4.2DepositorInsertsgRNA for APs6
UseCRISPRExpressionWormPromoterU6Available SinceJuly 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
AP324-3
Plasmid#66093Purposeco-expression of Cas9 and a sgRNA targeting 3'end of C.elegans K08F4.2DepositorInsertsgRNA for APs6
UseCRISPRExpressionWormPromoterU6Available SinceJuly 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
AP324-2
Plasmid#66092Purposeco-expression of Cas9 and a sgRNA targeting 3'end of C.elegans K08F4.2DepositorInsertsgRNA for APs6
UseCRISPRExpressionWormPromoterU6Available SinceJune 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
AP332-4
Plasmid#66091Purposeco-expression of Cas9 and a sgRNA targeting 5'end of C.elegans K08F4.2DepositorInsertsgRNA for APs4
UseCRISPRExpressionWormPromoterU6Available SinceJune 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
AP332-3
Plasmid#66090Purposeco-expression of Cas9 and a sgRNA targeting 5'end of C.elegans K08F4.2DepositorInsertsgRNA for APs4
UseCRISPRExpressionWormPromoterU6Available SinceJune 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
AP332-2
Plasmid#66089Purposeco-expression of Cas9 and a sgRNA targeting 5'end of C.elegans K08F4.2DepositorInsertsgRNA for APs4
UseCRISPRExpressionWormPromoterU6Available SinceJune 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
AP303-3
Plasmid#66087Purposeco-expression of Cas9 and a sgRNA targeting 5'end of C.elegans K08F4.2DepositorInsertsgRNA for APs1
UseCRISPRExpressionWormPromoterU6Available SinceJune 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
pT1-6xISRE-CNLCP-Hyg
Plasmid#253467Purposereporter assayDepositorInsertCyan Nano-lantern fused with CL1 and PEST
UseLuciferaseMutationNoneAvailable SinceJune 17, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9-GFP UGT2 (pWZ587)
Plasmid#254038PurposeExpress SpCas9 and the UGT2 gRNADepositorInsertgRNA_UGT2
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterU6Available SinceJune 10, 2026AvailabilityAcademic Institutions and Nonprofits only -
(pRZ219) AAV: U6-gRNA-EF1a-mScarlet
Plasmid#254585PurposeAAV backbone expressing a U6-driven sgRNA with SapI spacer and mScarlet from the EF1a promoterDepositorInsertsgRNA with SapI spacer
UseAAVAvailable SinceMay 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
(pRZ294) AAV: U6-gRNA-EF1a-ZsGreen
Plasmid#254586PurposeAAV backbone expressing a U6-driven sgRNA with SapI spacer and ZsGreen from the EF1a promoterDepositorInsertsgRNA with SapI spacer
UseAAVAvailable SinceApril 8, 2026AvailabilityAcademic Institutions and Nonprofits only -
(pRZ115) AAV: U6-gRNA-EF1a-mCherry
Plasmid#254584PurposeAAV backbone expressing a U6-driven sgRNA with SapI spacer and mCherry from the EF1a promoterDepositorInsertsgRNA with SapI spacer
UseAAVAvailable SinceApril 8, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSpyB-Tn7sg
Plasmid#248694PurposesgRNA expression vector - pBG35 promoter with Tn7sg negative control sgRNADepositorInsertTn7sg
ExpressionBacterialPromoterBG35Available SinceJan. 28, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCBS-4803
Plasmid#249321PurposeExpresses an sgRNA to target the KanR* site on the engineered E. coli MG1655 strain and contains the Repair Template to replace the KanR* on the genome of E. coli MG1655DepositorInsertsgRNA targeting the KanR* site
ExpressionBacterialMutationN/AAvailable SinceJan. 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCBS-5737
Plasmid#249326PurposeExpresses Non-targeting sgRNADepositorInsertnontargeting sgRNA
ExpressionYeastMutationN/AAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLenti-shDLD #2
Plasmid#242707PurposeshRNA knockdown human DLD geneDepositorInsertDLD (DLD Human)
UseLentiviralAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYO1124
Plasmid#235725PurposeExpression of human UVRAG (1-464) fused to human ATG14L BATS (413-492) in mammalian cellsDepositorInsertUVRAG(1-464) fused to ATG14L BATS domain (413-492)
ExpressionMammalianAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX330_REC8_cterm
Plasmid#222522PurposeCas9/sgRNA plasmid for targeting REC8DepositorInsertCas9, REC8 sgRNA (REC8 Human, Synthetic)
UseCRISPRAvailable SinceJan. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
hPLD4-sgRNA-Cas9_mcherry
Plasmid#199343Purposeencodes sgRNA for human PLD4 KO, (target Exon 5) plus Cas9-P2A-mCherryDepositorInserthSpCas9
UseCRISPRTagsP2A-mCherryExpressionMammalianMutationsgRNA: accagtagtatgaagccacgPromoterhuman U6Available SinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
AA233
Plasmid#215941PurposeFragmid fragment: (guide cassette) guide expression; positive control cell surface with 2xPP7 & 2xMS2 in trRNADepositorHas ServiceCloning Grade DNAInsertU6_v1; sgCD274_v1 [Sp]; trRNA_v14 [Sp]
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only