pBbS5c-PP_3456
(Plasmid
#86203)
-
PurposeExpresses efflux pump in E. coli to provide resistance to biofuel (low copy)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 86203 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBbS5c
- Backbone size w/o insert (bp) 4904
- Total vector size (bp) 9220
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert nameEfflux pump
-
Insert Size (bp)4316
- Promoter ATCGTTTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAAT
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer GATCTTTTAAGAAGGAGATATACATATGCCTACTACCCTCTCCC
- 3′ sequencing primer CCTTACTCGAGTTTGGATCCTCAGCTTTCGCGGGGCA (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameEfflux pump
-
Insert Size (bp)4316
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBbS5c-PP_3456 was a gift from Mary Dunlop (Addgene plasmid # 86203 ; http://n2t.net/addgene:86203 ; RRID:Addgene_86203) -
For your References section:
Trade-Offs in Improving Biofuel Tolerance Using Combinations of Efflux Pumps. Turner WJ, Dunlop MJ. ACS Synth Biol. 2015 Oct 16;4(10):1056-63. doi: 10.1021/sb500307w. Epub 2014 Dec 12. 10.1021/sb500307w PubMed 25496359