We narrowed to 8,865 results for: LIC
-
Plasmid#153891PurposeYeast expression plasmid for SARS-CoV-2 helicaseDepositorInsertSARS-CoV-2 helicase (ORF1ab Severe acute respiratory syndrome coronavirus 2)
TagsCleavable thrombin;StrepIIExpressionYeastMutationwtPromoterpGAL1Available sinceJune 12, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCDF11-SFPQ(214-535)
Plasmid#135439PurposeExpresses SFPQ 214-535 with TEV-cleavable hexahistidine tagDepositorInsertsplicing factor proline and glutamine rich (SFPQ Human)
TagsHexahistidineExpressionBacterialPromoterT7Available sinceMay 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGBW-m4046298
Plasmid#149015PurposeYeast Expression plasmid for SARS-CoV-2 helicaseDepositorInsertSARS-CoV-2 helicase (ORF1ab Severe acute respiratory syndrome coronavirus 2)
TagsCleavable thrombin;MBPExpressionYeastMutationwtPromoterpGAL1Available sinceMay 14, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
lentiCRISPRv2-Snrnp40
Plasmid#134255PurposeLentivector for Snrnp40 CRISPR knockoutDepositorInsertSnrp40 (Snrnp40 Mouse)
UseCRISPR and LentiviralMutationSnrnp40 gRNA “GATAACTATGCGACGTTGAA”PromoterU6Available sinceMarch 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHBDuet116
Plasmid#121915PurposeNpuDnaBΔ290ΔC39 inteinDepositorInsertOth-NpuDnaBΔ290ΔC39 intein
TagsHis6-GB1ExpressionBacterialMutationDeletion of 290-residue endonuclease domain, I53K…PromoterT7Available sinceDec. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHBS1506 [IBB-GFP-mCherry3E]-[BFP-TDP43 FYW-L]
Plasmid#133330PurposeTo test the effect of sequence on TDP43 splicing activityDepositorInsertTARDBP mutant (TARDBP Human)
ExpressionMammalianMutationAll FYW to L in CTD of full-length TDP43Available sinceNov. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHBS1507 [IBB-GFP-mCherry 3E]-[BFP-TDP43 VLIM-S]
Plasmid#133331PurposeTo test the effect of sequence on TDP43 splicing activityDepositorInsertTARDBP mutant (TARDBP Human)
ExpressionMammalianMutationAll VLIM to S in CTD of full-length TDP43Available sinceNov. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHBS1508 [IBB-GFP-mCherry 3E]-[BFP-TDP43 VLIM-F]
Plasmid#133332PurposeTo test the effect of sequence on TDP43 splicing activityDepositorInsertTARDBP mutant (TARDBP Human)
ExpressionMammalianMutationAll VLIM to F in CTD of full-length TDP43Available sinceNov. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T-3-cytXlATL2-R232Q
Plasmid#124064PurposeControl protein. The R232Q mutation abolishes dimerization activity, so this construct is inactive compared to wild type cytATLDepositorInsertcytXlATL2-R232Q
ExpressionBacterialPromotertacAvailable sinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) hYAP 1-2delta
Plasmid#124154PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable sinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) hYAP 1-1alpha
Plasmid#124147PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable sinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) hYAP 1-1beta
Plasmid#124148PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable sinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) hYAP 1-1gamma
Plasmid#124149PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable sinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) hYAP 1-2alpha
Plasmid#124151PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable sinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) hYAP 1-2beta
Plasmid#124152PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable sinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) hYAP 1-2gamma
Plasmid#124153PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable sinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) hYAP 1-1delta
Plasmid#124150PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable sinceApril 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHBS1401 [IBB-GFP-mCherry3E]-[BFP-P2A-TDP43 F-S]
Plasmid#118808PurposeTo test the effect of sequence on TDP43 splicing activityDepositorInsertTARDBP mutant (TARDBP Human)
ExpressionMammalianMutationAll F to S in CTD of full-length TDP43Available sinceFeb. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHBS1201 [IBB-GFP-mCherry3E]-[BFP-P2A-TDP43 6xΦ]
Plasmid#107846PurposeTo test the effect of sequence on TDP43 splicing activityDepositorInsertTARDBP mutant (TARDBP Human)
ExpressionMammalianMutationAll hydrophobics combined in six clusters in spli…Available sinceApril 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSi-check2-hRac2 3'UTR
Plasmid#97160PurposeFor dual luciferase report assayDepositorInsertRAC 3'UTR (AKT1 Human)
ExpressionMammalianAvailable sinceOct. 23, 2017AvailabilityAcademic Institutions and Nonprofits only