We narrowed to 8,865 results for: LIC
-
Plasmid#186846PurposeDoxycycline-dependent expression of orangutan cGAS gene in mammalian cells by retroviral transductionDepositorInsertOrangutan cGAS truncation mutant (158-521 a.a.) with C-terminal GFP tag (CGAS Pongo abelii, Synthetic)
UseRetroviralTagsGFPMutationN-terminal truncationPromoterTRE3GAvailable sinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-chimpanzee cGASdeltaN-GFP
Plasmid#186847PurposeDoxycycline-dependent expression of chimpanzee cGAS gene in mammalian cells by retroviral transductionDepositorInsertChimpanzee cGAS truncation mutant (160-520 a.a.) with C-terminal GFP tag (CGAS Pan troglodytes, Synthetic)
UseRetroviralTagsGFPMutationN-terminal truncationPromoterTRE3GAvailable sinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-HA-human cGASdeltaN
Plasmid#186852PurposeDoxycycline-dependent expression of human cGAS gene in mammalian cells by retroviral transductionDepositorInsertHuman cGAS truncation mutant (160-522 a.a.) with N-terminal HA tag (Adamts1 Human, Synthetic)
UseRetroviralTagsHAMutationN-terminal truncationPromoterTRE3GAvailable sinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-human cGASdeltaN
Plasmid#186854PurposeDoxycycline-dependent expression of human cGAS gene in mammalian cells by retroviral transductionDepositorInsertHuman cGAS truncation mutant (160-522 a.a.) without tags (Adamts1 Human, Synthetic)
UseRetroviralMutationN-terminal truncationPromoterTRE3GAvailable sinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
macroH2A1.2-F192V-GFP (pc5115)
Plasmid#223438PurposeMutation phenylalanine 192 to valine (F192V) in macroH2A1.2-GFPDepositorInsertmacroH2A1.2-F192V (Macroh2a1 Rat)
TagsGFPExpressionMammalianMutationMutation of phenylalanine 192 to valine (F192V)PromoterCMVAvailable sinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1297-AAV-EFSNC-dCjCas9-HP1b(79-173)
Plasmid#223142PurposeExpression of truncated HP1b with dCjCas9 and empty gRNA scaffoldDepositorInsertHP1b (CBX1 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 79-173PromoterEF1aAvailable sinceAug. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1298-AAV-EFSNC-dCjCas9-HP1bNH(111-173)
Plasmid#223143PurposeExpression of truncated HP1b with dCjCas9 and empty gRNA scaffoldDepositorInsertHP1b (CBX1 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 111-173PromoterEF1aAvailable sinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1308-AAV-EFSNC-dSaCas9-HP1bNH(111-173)
Plasmid#223153PurposeExpression of truncated HP1b with dSaCas9 and empty gRNA scaffoldDepositorInsertHP1b (CBX1 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 111-173PromoterEF1aAvailable sinceAug. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1313-AAV-EFSNC-dSaCas9-MECP2(204-310)
Plasmid#223158PurposeExpression of truncated MECP2 with dSaCas9 and empty gRNA scaffoldDepositorInsertMECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310PromoterEF1aAvailable sinceAug. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1307-AAV-EFSNC-dSaCas9-HP1b(79-173)
Plasmid#223152PurposeExpression of truncated HP1b with dSaCas9 and empty gRNA scaffoldDepositorInsertHP1b (CBX1 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 79-173PromoterEF1aAvailable sinceAug. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pmch-mTet1-ZF-CD pc3956
Plasmid#201709PurposeExpresses of mcherry-tagged mTet1-ZF-CD in mammalian cellsDepositorInsertTet1-ZF_CD (Tet1 Mouse)
TagsmCherryExpressionMammalianMutationZinc finger domain of Tet1 fused to its catalytic…PromoterCAGAvailable sinceJuly 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
Polymerase expression - pCMV-ePhi29(+exo) (LM2995)
Plasmid#208966PurposeUnfused ePhi29 DNA polymerase (+exo), expressed from CMV or T7 promoters.DepositorInsertePhi29(+exo)-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationePhi29(+exo)(M8R/V51A/M97T/G197D/E221K/Q497P/K512…PromoterCMV and T7Available sinceFeb. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available sinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-rCD20-BSD
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available sinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1AUC-DelStem-CD20-Puro
Plasmid#209758PurposeLentiviral transfer plasmid to express the 5'-UTR and CDS of the human CD20 gene, MS4A1; variant 1 mRNA isoform with mutations to disrupt the uORFs and the stem-loop within the 5'-UTR.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationMutations to disrupt the uORFs and the stem-loop …Available sinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
Recruited polymerase expression - pCMV-T7-ePhi29-CC(N5) (LM2719)
Plasmid#208973PurposeRecruited ePhi29 DNA polymerase (-exo), with a C-terminal N5 coiled coil (CC) domain, expressed from CMV or T7 promoters.DepositorInsertePhi29-BPNLS-CC(N5)
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationePhi29(-exo)(D169A;M8R/V51A/M97T/G197D/E221K/Q497…PromoterCMV and T7Available sinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
SUMO-Twinkle 43-372
Plasmid#205054PurposeTWNK protein expressionDepositorInsertTWNK (TWNK Human)
ExpressionBacterialMutationLacks Mitochondrial localization signal and C ter…Available sinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
SUMO-Twinkle 360-684
Plasmid#205055PurposeTWNK protein expressionDepositorAvailable sinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET-Duet-6xHis-TEV-Nsp8(76-198)
Plasmid#201024PurposeBacterial expression of codon optimized SARS-CoV-2 nsp8 residues 76-198, with an N-terminus His tag followed by a TEV cleavage site.DepositorInsertnon-structural protein 8 (ORF1ab Severe acute respiratory syndrome coronavirus 2, Synthetic)
Tags6xHis-TEVExpressionBacterialMutationGene insert is codon optimized for Ecoli.PromoterT7/LacOAvailable sinceMay 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pnYC-NvM-DmBam_AG
Plasmid#148831PurposeBacterial Expression of DmBamDepositorInsertDmBam (bam Fly)
ExpressionBacterialMutationone non silent mutation A239 to S, described as …Available sinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only