We narrowed to 19,081 results for: cat
-
Plasmid#235448PurposeHelper plasmid with sfGFP gene inserted at gene VIII locusDepositorInsertCoding part of the M13KO7 helper phage genome, except gene VIII
ExpressionBacterialAvailable SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
WT FLAG-HaloTag-RTEL1_DonorVector
Plasmid#247170PurposeHR Donor for WT C-terminal FLAG-HaloTag-RTEL1 fusion in human cells. Includes Puro selection marker.DepositorInsertWT FLAG-HaloTag-RTEL1 (RTEL1 Human)
PromoterEndogenous RTEL1 promoterAvailable SinceOct. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLVXNeo_SPARC-mSc-SBP
Plasmid#234885PurposeExpresses mScarlet-i and SBP tagged human SPARC for protein visualisation and use in the RUSH trafficking systemDepositorInsertSPARC (SPARC Human)
UseLentiviralTagsSBP and mScarletiExpressionMammalianMutationN/APromoterCMVAvailable SinceOct. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEM_H3.2-HaloTag
Plasmid#244240PurposeCRISPR/Cas9 donor plasmid to tag human histone H3.2 with Halo tagDepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-NES-SomajRGECO1a
Plasmid#232842PurposeAAV transfer plasmid for Syn-mediated expression of soma-targeted jRGECO1aDepositorInsertNES-SomajRGECO1a
UseAAVTagsnuclear export sequence, 6xHis, T7, Xpress tagExpressionMammalianPromoterSynAvailable SinceJune 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-NT-1mer-gRNA
Plasmid#227500Purposenon-targeting control guideDepositorInsertNon-targeting gRNA
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pQdCas12a.luxR(mut)-sggfp(C)
Plasmid#236043PurposeThe plasmid pQdCas12a.luxR(mut)-sggfp(C) expresses the dCas12a endonuclease and the sgRNA (design C) targeting the gfp gene. Additionally, it contains a mutation in the luxR gene.DepositorInsertquorum sensing cassette luxI, mutated luxR, and the LuxR-dependent promoter pLuxI , dCas12a and sgRNA design (C) of gfp gene
UseCRISPRPromoterquorum sensing promoterAvailable SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
sgTAZ-R-3
Plasmid#229450Purposeknockout of WWTR1 (TAZ)DepositorAvailable SinceDec. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-SLC25A46[R257Q]-P2A-Electra1 (pAH11)
Plasmid#227616PurposeOverexpression of SLC25A46 with R257Q mutation in mammalian cell linesDepositorInsertSLC25A46 (SLC25A46 Human)
TagsP2A-mElectra1ExpressionMammalianMutationR257QPromoterCMV, T7Available SinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML107-PMR1
Plasmid#226264PurposePlasmid expressing Cas9 and gRNA ACATGACCGTATCTAAACTT which targets the PMR1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHDR2_DAZL-T2A-mGreenLantern-PuroTK
Plasmid#222917PurposeHomology directed repair template for knocking in mGreenLantern reporter to DAZL.DepositorInsertmGreenLantern
UseCRISPRAvailable SinceJuly 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPB-cT3G-cERP2-FIGLA
Plasmid#222929PurposePiggyBac transposon plasmid for doxycycline inducible expression of FIGLADepositorInsertFIGLA (FIGLA Human)
ExpressionMammalianAvailable SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLX-UBC_NKX2-1
Plasmid#221495PurposeNKX2-1 short isoform lentiviral overexpression using UBC promoterDepositorAvailable SinceJuly 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLX-hPGK_NKX2-1
Plasmid#221494PurposeNKX2-1 short isoform lentiviral overexpression using hPGK promoterDepositorAvailable SinceJuly 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pC1-lifeact-oROS-HT
Plasmid#216420PurposeTargeting of the chemigenetic, fluorescent peroxide sensor oROS-HT to actin filaments.DepositorInsertlifeact-oROS-HT
ExpressionMammalianPromoterCMVAvailable SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-N1303K-ngRNA+14_EF1a-puroR
Plasmid#207359PurposeLentiviral transfer plasmid encoding hU6-driven expression of a ngRNA for correction of N1303K-CFTR via prime editing and EF1a-driven puromycin resistance gene.DepositorInsertN1303K-CFTR +14 ngRNA
UseLentiviralAvailable SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
12URA-B-ScTop2∆CTD
Plasmid#214924PurposeYeast expression vector 6xHisTag-TEV at N terminus to express S cerevisiae topoisomerase II (1–1177)DepositorInserttopoisomerase II
Tags6x His-TEVExpressionYeastMutationDeleted amino acids 1178-1428PromoterGal 1/10Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(GATA3(13))-PGKpuro2ABFP-W
Plasmid#208548PurposeLentiviral vector expressing gRNA targeting human GATA3DepositorInsertGATA3(13) (GATA3 Human)
UseLentiviralAvailable SinceJan. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAf-CRISPR-phoA
Plasmid#207991PurposeCRISPR vector used with pAf-CRISPR-ctfR1 (#207992) to delete both aflatoxin and cyclopiazonic acid gene clusters of Aspergillus flavusDepositorInsertphoA
UseCRISPRPromoterAspergillus flavus U6Available SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKT-CNP-inact
Plasmid#211804PurposeExpresses inactive 2',3'-cyclic nucleotide phosphodiesterase catalytic domain (catalytic residues mutated)DepositorInsert2',3'-cyclic nucleotide phosphodiesterase catalytic domain (Cnp Rat)
ExpressionBacterialMutationH73L H153LPromotertetAvailable SinceDec. 21, 2023AvailabilityAcademic Institutions and Nonprofits only