We narrowed to 1,903 results for: sfGFP
-
Plasmid#56489PurposeLocalization: Intermediate Filaments, Excitation: 485, Emission: 507DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertVimentin (VIM Human)
TagssfGFPExpressionMammalianPromoterCMVAvailable sinceJan. 13, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
pTone-gata2aECE-nsGFP
Plasmid#132975Purposegata2a endothelial enhancer (x6) and basal promoter driving nuclear-localized sfGFP in pTol1 backboneDepositorInsertsnuclear localized sfGFP
gata2a endothelial enhancer (x6) with a carp b-actin basal promoter
UseUnspecified; Transposon-mediatedTags6x myc and SV40 NLSAvailable sinceDec. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHR-DHFRY100I-sfGFP-NLS-P2A-NLS-mCherry-P2A_ ARHGAP5 5' and 3'UTR
Plasmid#67931PurposeTranslational reporter - ARHGAP5 UTRsDepositorAvailable sinceSept. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
SIN40C.TRE.HA.RUNX1C.IRES.dTomato.PGK.sfGFP.P2A.Tet3G
Plasmid#181978PurposeHuman RUNX1C gene overexpressionDepositorAvailable sinceApril 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
SIN40C.TRE.dTomato.miR30n.PGK.sfGFP.P2A.Tet3G
Plasmid#169282PurposeDoxycycline-inducible overexpression of miRNA or shRNA with dTomato as a reporter fluorescent proteinDepositorTypeEmpty backboneUseLentiviral and RNAiAvailable sinceJuly 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
SIN40C.TRE.ARID3a.IRES.dTomato.PGK.sfGFP.P2A.Tet3G
Plasmid#169314PurposeDoxycycline-inducible expression of human ARID3A cDNA with dTomato as reporter fluorescent proteinDepositorAvailable sinceJuly 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPB_TRE3G_scFV-sfGFP-Kmt5cFL
Plasmid#235581PurposeDox-inducible expression of the catalytic-domain (CD) of epigenetic effector Kmt5c fused with scFV to programme H4K20me3DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertKmt5c (Kmt5c Mouse)
UseCRISPRAvailable sinceApril 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJBL7345
Plasmid#217372PurposesfGFP reporter for chimeric riboswitch with Cbe pfl ZTP riboswitch aptamer and WT Pca rhtB ZTP riboswitch expression platformDepositorPublicationInsertChimeric ZTP riboswitch with Cbe pfl aptamer and WT Pca rhtB expression platform sfGFP reporter
Available sinceNov. 22, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pPB_TRE3G_scFV-sfGFP-Dot1LCD
Plasmid#235582PurposeDox-inducible expression of the catalytic-domain (CD) of epigenetic effector Dot1l fused with scFV to programme H3K79me2DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertDot1l (Dot1l Mouse)
UseCRISPRAvailable sinceApril 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPB_TRE3G_scFV-sfGFP-Setd2CD
Plasmid#235579PurposeDox-inducible expression of the catalytic-domain (CD) of epigenetic effector Setd2 fused with scFV to programme H3K36me3DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertSetd2 (Setd2 Mouse)
UseCRISPRAvailable sinceApril 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
sfGFP-FAK-5
Plasmid#56484PurposeLocalization: Focal Adhesion Kinase, Excitation: 485, Emission: 507DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertFAK
TagssfGFPExpressionMammalianPromoterCMVAvailable sinceJan. 13, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSLC-254
Plasmid#124291PurposeExpression of vsfGFP-0. This construct improves brightness of sfGFP by fusing a GFP-specific single domain antibody to it that creates a dimeric fluorophore.DepositorInsertvsfGFP-0
ExpressionBacterialAvailable sinceSept. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
Pinducer20-BSD-scFv-sfGFP-DNMT3A1
Plasmid#115780Purposetargeted DNA methylation toolDepositorAvailable sinceOct. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET22b-T5-sfGFP*-XcP4H-MH4R
Plasmid#178043PurposeExpress green fluorescent protein with TAG at 151 position and enzymes to biosynthesize 5HTPDepositorInsertssuperfolder green fluorescent protein with TAG at 151 position
XcP4H with W179F mutation
dihydropterine reductase from human
pterin-4a-carbinolamine dehydratase from human
TagsHis tagExpressionBacterialAvailable sinceApril 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMRS-BG35-GFP
Plasmid#220201Purposemini-Tn7 GFP expression vector - pBG35 promoterDepositorInsertmonomeric superfolder green fluorescent protein
UseCRISPRExpressionBacterialMutationmonomeric superfolder green fluorescent proteinPromoterpBG35Available sinceSept. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMRS-GFP
Plasmid#220197Purposemini-Tn7 GFP expression vectorDepositorInsertmonomeric superfolder green fluorescent protein
UseCRISPRExpressionBacterialMutationmonomeric superfolder green fluorescent proteinPromoterpromoterlessAvailable sinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAP05
Plasmid#186261PurposesfGFP under light light responsive PEL222 promoter and EL222 under constitutively active BBa_J2305 promoterDepositorInsertsExpressionBacterialPromoterBBa_23105 (GGCTAGCTCAGTCCTAGGTACTATGCTAGC) and PE…Available sinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMJ915v2 + sfGFP
Plasmid#88918PurposeFor expression of modified SpyCas9 in e.coli.DepositorInsertsCas9
T7
UseCRISPRExpressionBacterialAvailable sinceMay 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
RHPMP192 (pLifeAct sfGFP)
Plasmid#88843PurposeLocalization by Fluorescence microscopy of lifeAct fused to super folder GFPDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertLifeAct
TagssfGFPExpressionMammalianPromoterCMVAvailable sinceMay 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBMN-FKBP DD(L106P)-UbK0G75S-sfGFP
Plasmid#170157PurposeExpression for LIBRON constructsDepositorInsertFKBP DD (L106P)-UbK0G75S
UseRetroviralTagssfGFPMutationchange all lysin residues of ubiquitin to Arg, G7…Available sinceAug. 12, 2021AvailabilityAcademic Institutions and Nonprofits only