Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

Pinducer20-BSD-scFv-sfGFP-DNMT3A1
(Plasmid #115780)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 115780 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    Pinducer 20
  • Backbone manufacturer
    Stephen Elledge
  • Backbone size w/o insert (bp) 11791
  • Total vector size (bp) 14447
  • Vector type
    Mammalian Expression
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    scFv-sfGFP-DNMT3A1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    4500
  • Entrez Gene
    DNMT3A (a.k.a. DNMT3A2, HESJAS, M.HsaIIIA, TBRS)
  • Promoter TRE

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer GGGGACAAGTTTGTACAAAAAAGCAGGCTCCATGGGCCCCGACATCGTGATGAC
  • 3′ sequencing primer GGGGACCACTTTGTACAAGAAAGCTGGGTCttacacacacgcaaaatactccttcagc
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Pinducer20-BSD-scFv-sfGFP-DNMT3A1 was a gift from Margaret Goodell (Addgene plasmid # 115780 ; http://n2t.net/addgene:115780 ; RRID:Addgene_115780)
  • For your References section:

    Homeobox oncogene activation by pan-cancer DNA hypermethylation. Su J, Huang YH, Cui X, Wang X, Zhang X, Lei Y, Xu J, Lin X, Chen K, Lv J, Goodell MA, Li W. Genome Biol. 2018 Aug 10;19(1):108. doi: 10.1186/s13059-018-1492-3. 10.1186/s13059-018-1492-3 [pii] PubMed 30097071