pCMV-dCas9-mD3A
(Plasmid
#78257)
-
PurposeExpresses dead Cas9 (dCas9) fused to inactive DNMT3A catalytic domain (CD) under the control of the CMV promoter
-
Depositing Lab
-
Depositing OrganizationWashington University in Saint Louis
Located in the United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 78257 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 78257-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 78257-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCMV
- Total vector size (bp) 14357
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDNMT3A CD aa 598-912
-
SpeciesH. sapiens (human)
-
Insert Size (bp)948
-
MutationE756A
-
GenBank IDAF480163
-
Entrez GeneDNMT3A (a.k.a. DNMT3A-3, DNMT3A2, HESJAS, M.HsaIIIA, TBRS)
- Promoter pCMV
-
Tag
/ Fusion Protein
- Flag epitope tag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site AgeI (not destroyed)
- 5′ sequencing primer ctgcagccttcaagtacttcgacacc
- 3′ sequencing primer tacaaaggcattaaagcagcgta
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 78257-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 78257-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-dCas9-mD3A was a gift from Grant Challen (Addgene plasmid # 78257 ; http://n2t.net/addgene:78257 ; RRID:Addgene_78257) -
For your References section:
Reprogrammable CRISPR/Cas9-based system for inducing site-specific DNA methylation. McDonald JI, Celik H, Rois LE, Fishberger G, Fowler T, Rees R, Kramer A, Martens A, Edwards JR, Challen GA. Biol Open. 2016 May 11. pii: bio.019067. doi: 10.1242/bio.019067. 10.1242/bio.019067 PubMed 27170255