Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pCMV-dCas9-mD3A
(Plasmid #78257)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 78257 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    DNMT3A CD aa 598-912
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    948
  • Mutation
    E756A
  • GenBank ID
    AF480163
  • Entrez Gene
    DNMT3A (a.k.a. DNMT3A2, HESJAS, M.HsaIIIA, TBRS)
  • Promoter pCMV
  • Tag / Fusion Protein
    • Flag epitope tag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site AgeI (not destroyed)
  • 5′ sequencing primer ctgcagccttcaagtacttcgacacc
  • 3′ sequencing primer tacaaaggcattaaagcagcgta
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV-dCas9-mD3A was a gift from Grant Challen (Addgene plasmid # 78257 ; http://n2t.net/addgene:78257 ; RRID:Addgene_78257)
  • For your References section:

    Reprogrammable CRISPR/Cas9-based system for inducing site-specific DNA methylation. McDonald JI, Celik H, Rois LE, Fishberger G, Fowler T, Rees R, Kramer A, Martens A, Edwards JR, Challen GA. Biol Open. 2016 May 11. pii: bio.019067. doi: 10.1242/bio.019067. 10.1242/bio.019067 PubMed 27170255