Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of the Addgene plasmid sequence database.

Information

In Category

We narrowed to 10 results for: arl

Showing: 1 - 10 of 10 results

  1. Adenovirus Guide

    Type
    Guide
    ... divided into early (E1A, E1B, E2, E3, E4) and late (L1, L2, L3, L4, L5) regions. Early transcripts are...5 (Ad5) and have been produced by replacing the early and late adenoviral transcript regions between the...rAdV vectors, as well as the deletion of the other early gene regions, E2 and E4. These modifications aimed... when administered in vivo, however deletion of early genes also resulted in a reduction of viral vector...Adenoviral plasmid E2A, E2B, E3, E4 in trans Adenoviral early transcript regions involved in viral DNA replication...

  2. Sequencing Primers

    Type
    Guide
    ...CGCAAATGGGCGGTAGGCGTG (Invitrogen) Human CMV immediate early promoter, forward primer LKO.1 5' GACTATCATATGCTTACCGT...CGCAAATGGGCGGTAGGCGTG (Invitrogen) Human CMV immediate early promoter, forward primer CRE-R GCAAACGGACAGAAGCATTT...primer pLTet-F ACTGAGCACATCAGCAGGAC Lambda phage early leftward (pL) promoter, forward primer pLXSN 5' ...pMRB101-F AAGATGCAGGCAGCTGAGTT HCMV major immediate-early protein (IE), forward primer pMT2-F TTGCCTTTCTCTCCACAGGT...

  3. CRISPR Guide

    Type
    Guide
    ...techniques are referred to as CRISPR ( C lustered R egularly I nterspaced S hort P alindromic R epeat) technologies...AcrVA3.1, which inhibits both Cas12a and Cas3. Similarly, some Acr proteins are specific to a particular...editors are based on cytosine base editors and similarly work by first converting cytidine to uridine. ...with the sequence, so the edit is not considered “scarless”. Figure 7: Overview of CRISPR transposases Browse...by cutting only one strand CRISPR C lustered R egularly I nterspaced S hort P alindromic R epeat, a bacterial... Yang, L., Esvelt, K. M., Aach, J., Guell, M., DiCarlo, J. E., Norville, J. E., & Church, G. M. (2013)...

  4. Chemogenetics Guide

    Type
    Guide
    ...Chemogenetics Guide Jump To: Chemogenetics Guide Early Chemogenetic Receptors: RASSLs DREADDs PSAMs LMOs...General overview of a chemogenetics experiment. Early Chemogenetic Receptors: RASSLs The first chemogenetic...

  5. Optogenetics Guide

    Type
    Guide
    ...and light oxygen voltage (LOV) domains function similarly to cryptochromes with light-induced changes in...Synthetic Neurobiology Group Optogenetics Resources Karl Deisseroth's Lab: Optogenetics Resource Center Boyden...

  6. Molecular Biology Reference

    Type
    Guide
    ...of phenotypic information was introduced in the early 19th century by Gregor Mendel, who later demonstrated...clones of the original cell. The plasmid DNA is similarly referred to as cloned DNA, and this process of...

  7. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...viral genome. Helper plasmid E4 in trans Adenoviral early gene that encodes for proteins essential for AAV...replication and packaging. E2A in trans Adenoviral early gene that encodes a DNA-binding protein (DBP) that...

  8. Science Guides

    Type
    Guide
    ...activity. Read More CRISPR Class 2 C lustered R egularly I nterspaced S hort P alindromic R epeat (CRISPR...

  9. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...antigen receptor T cell (CAR-T) therapy is a particularly popular application of gamma-retroviral vectors...

  10. Lentiviral Vector Guide

    Type
    Guide
    ...delivery of gene therapies. Lentiviral vectors are particularly effective for stem cell therapies, which rely...
Showing: 1 - 10 of 10 results