This website uses cookies to ensure you get the best experience. By continuing the use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

Plasmid Features


This page shows the candidate plasmid features used by Addgene's plasmid mapping program if full sequence of a plasmid is provided.

Feature Type Sequence
3_AcPH Feature
GACTCTGCTGAAGAGGAGGAAATTCTCCTTGAAGTTTCCCTGGTGTTCAAAGTAAAGGAGTTTGCACCAGACGCACCTCT
GTTCACTGGTCCGGCGTATTAA
5xGal4_DBD Feature
CGGAGTACTGTCCTCCGAGCGGAGTACTGTCCTCCGAGCGGAGTACTGTCCTCCGAGCGGAGTACTGTCCTCCGAGCGGA
GTACTGTCCTCCGAG
5_LTR Feature
AACGCCATTTTGCAAGGCATGGAAAAATACATAACGCATGCCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAA
TGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAG
GGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCA
AGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCC
TACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGAT
AGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGG
GACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAG
CAGAGATGCATCCTCACTCGGGGCGCCAGTCCTCCGATTGACTGAGTCGCCCGGGTACCCGTGTATCCAATAAACCCTCT
TGCAGTTGCATCCGACTTGTGGTCTCGCTGTTCCTTGGGAGGGTCTCCTCTGAGTGATTGACTACCCGTCAGCGGGGGTC
TTTCATT
5_LTR2 Feature
AACGCCATTTTGCAAGGCATGGAAAAATACATAACTGAGAATAGAAAAGTTCAGATCAAGGTCAGGAACAGATGGAACAG
CTGAATATGGGCCAAAGCGGATATCTGTGGTAAGCAGTTCCTGCCCCGGCTCAGGGCCAAGAACAGATGGAACAGCTGAA
TATGGGCCAAACAGGATATCTGTGGTAAGCAGTTCCTGCCCCGGCTCAGGGCCAAGAACAGATGGTCCCCAGATGCGGTC
CAGCCCTCAGCAGTTTCTAGAGAACCATCAGATGTTTCCAGGGTGCCCCAAGGACCTGAAATGACCCTGTGCCTTATTTG
AACTAACCAATCAGTTCGCTTCTCGCTTCTGTTCGCGCGCTTCTGCTCCCCGAGCTCAATAAAAGAGCCCACAACCCCTC
ACTCGGGGCGCCAGTCCTCCGATTGACTGAGTCGCCCGGGTACCCGTGTATCCAATAAACCCTCTTGCAGTTGCATCCGA
CTTGTGGTCTCGCTGTTCCTTGGGAGGGTCTCCTCTGAGTGATTGACTACCCGTCAGCGGGGGTCTTTCATT
Ac_3_flank Feature
GTTATTAGTACATTTATTAAGCGCTAGATTCTGTGCGTTGTTGATTTACAGACAATTGTTGTACGTATTTTAATAATTCA
TTAAATTTATAATCTTTAGGGTGGTATGTTAGAGCGAAAATCAAATGATTTTCAGCGTCTTTATATCTGAATTTAAATAT
TAAATCCTCAATAGATTTGTAAAATAGGTTTCGATTAGTTTCAAACAAGGGTTGTTTTTCCGAACCGATGGCTGGACTAT
CTAATGGATTTTCGCTCAACGCCACAAAACTTGCCAAATCTTGTAGCAGCAATCTAGCTTTGTCGATATTCGTTTGTGTT
TTGTTTTGTAATAAAGGTTCGACGTCGTTCAAAATATTATGCGCTTTTGTATTTCTTTCATCACTGTCGTTAGTGTACAA
TTGACTCGACGTAAACACGTTAAATAAAGCTTGGACATATTTAACATCGGGCGTGTTAGCTTTATTAGGCCGATTATCGT
CGTCGTCCCAACCCTCGTCGTTAGAAGTTGCTTCCGAAGACGATTTTGCCATAGCCACACGACGCCTATTAATTGTGTCG
GCTAACACGTCCGCGATCAAATTTGTAGTTGAGCTTTTTGGAATTATTTCTGATTGCGGGCGTTTTTGGGCGGGTTTCAA
TCTAACTGTGCCCGATTTTAATTCAGACAACACGTTAGAAAGCGATGGTGCAGGCGGTGGTAACATTTCAGACGGCAAAT
CTACTAATGGCGGCGGTGGTGGAGCTGATGATAAATCTACCATCGGTGGAGGCGCAGGCGGGGCTGGCGGCGGAGGCGGA
GGCGGAGGTGGTGGCGGTGATGCAGACGGCGGTTTAGGCTCAAATGTCTCTTTAGGCAACACAGTCGGCACCTCAACTAT
TGTACTGGTTTCGGGCGCCGTTTTTGGTTTGACCGGTCTGAGACGAGTGCGATTTTTTTCGTTTCTAATAGCTTCCAACA
ATTGTTGTCTGTCGTCTAAAGGTGCAGCGGGTTGAGGTTCCGTCGGCATTGGTGGAGCGGGCGGCAATTCAGACATCGAT
GGTGGTGGTGGTGGTGGAGGCGCTGGAATGTTAGGCACGGGAGAAGGTGGTGGCGGCGGTGCCGCCGGTATAATTTGTTC
TGGTTTAGTTTGTTCGCGCACGATTGTGGGCACCGGCGCAGGCGCCGCTGGCTGCACAACGGAAGGTCGTCTGCTTCGAG
GCAGCGCTTGGGGTGGTGGCAATTCAATATTATAATTGGAATACAAATCGTAAAAATCTGCTATAAGCATTGTAATTTCG
CTATCGTTTACCGTGCCGATATTTAACAACCGCTCAATGTAAGCAATTGTATTGTAAAGAGATTGTCTCAAGCTCGGATC
GATCCCGCACGCCGATAACAAGCCTTTTCATTTTTACTACAGCATTGTAGTGGCGAGACACTTCGCTGTCGTCG
Ac_5_flank Feature
AACGGCTCCGCCCACTATTAATGAAATTAAAAATTCCAATTTTAAAAAACGCAGCAAGAGAAACATTTGTATGAAAGAAT
GCGTAGAAGGAAAGAAAAATGTCGTCGACATGCTGAACAACAAGATTAATATGCCTCCGTGTATAAAAAAAATATTGAAC
GATTTGAAAGAAAACAATGTACCGCGCGGCGGTATGTACAGGAAGAGGTTTATACTAAACTGTTACATTGCAAACGTGGT
TTCGTGTGCCAAGTGTGAAAACCGATGTTTAATCAAGGCTCTGACGCATTTCTACAACCACGACTCCAAGTGTGTGGGTG
AAGTCATGCATCTTTTAATCAAATCCCAAGATGTGTATAAACCACCAAACTGCCAAAAAATGAAAACTGTCGACAAGCTC
TGTCCGTTTGCTGGCAACTGCAAGGGTCTCAATCCTATTTGTAATTATTGAATAATAAAACAATTATAAATGCTAAATTT
GTTTTTTATTAACGATACAAACCAAACGCAACAAGAACATTTGTAGTATTATCTATAATTGAAAACGCGTAGTTATAATC
GCTGAGGTAATATTTAAAATCATTTTCAAATGATTCACAGTTAATTTGCGACAATATAATTTTATTTTCACATAAACTAG
ACGCCTTGTCGTCTTCTTCTTCGTATTCCTTCTCTTTTTCATTTTTCTCCTCATAAAAATTAACATAGTTATTATCGTAT
CCATATATGTATCTATCGTATAGAGTAAATTTTTTGTTGTCATAAATATATATGTCTTTTTTAATGGGGTGTATAGTACC
GCTGCGCATAGTTTTTCTGTAATTTACAACAGTGCTATTTTCTGGTAGTTCTTCGGAGTGTGTTGCTTTAATTATTAAAT
TTATATAATCAATGAATTTGGGATCGTCGGTTTTGTACAATATGTTGCCGGCATAGTACGCAGCTTCTTCTAGTTCAATT
ACACCATTTTTTAGCAGCACCGGATTAACATAACTTTCCAAAATGTTGTACGAACCGTTAAACAAAAACAGTTCACCTCC
CTTTTCTATACTATTGTCTGCGAGCAGTTGTTTGTTGTTAAAAATAACAGCCATTGTAATGAGACGCACAAACTAATATC
ACAAACTGGAAATGTCTATCAATATAT
AraC Feature
ATGGCTGAAGCGCAAAATGATCCCCTGCTGCCGGGATACTCGTTTAATGCCCATCTGGTGGCGGGTTTAACGCCGATTGA
GGCCAACGGTTATCTCGATTTTTTTATCGACCGACCGCTGGGAATGAAAGGTTATATTCTCAATCTCACCATTCGCGGTC
AGGGGGTGGTGAAAAATCAGGGACGAGAATTTGTTTGCCGACCGGGTGATATTTTGCTGTTCCCGCCAGGAGAGATTCAT
CACTACGGTCGTCATCCGGAGGCTCGCGAATGGTATCACCAGTGGGTTTACTTTCGTCCGCGCGCCTACTGGCATGAATG
GCTTAACTGGCCGTCAATATTTGCCAATACGGGGTTCTTTCGCCCGGATGAAGCGCACCAGCCGCATTTCAGCGACCTGT
TTGGGCAAATCATTAACGCCGGGCAAGGGGAAGGGCGCTATTCGGAGCTGCTGGCGATAAATCTGCTTGAGCAATTGTTA
CTGCGGCGCATGGAAGCGATTAACGAGTCGCTCCATCCACCGATGGATAATCGGGTACGCGAGGCTTGTCAGTACATCAG
CGATCACCTGGCAGACAGCAATTTTGATATCGCCAGCGTCGCACAGCATGTTTGCTTGTCGCCGTCGCGTCTGTCACATC
TTTTCCGCCAGCAGTTAGGGATTAGCGTCTTAAGCTGGCGCGAGGACCAACGTATCAGCCAGGCGAAGCTGCTTTTGAGC
ACCACCCGGATGCCTATCGCCACCGTCGGTCGCAATGTTGGTTTTGACGATCAACTCTATTTCTCGCGGGTATTTAAAAA
ATGCACCGGGGCCAGCCCGAGCGAGTTCCGTGCCGGTTGTGAAGAAAAAGTGAATGATGTAGCCGTCAAGTTGTCATAA
AraI1I2 Feature
ATAGCATTTTTATCCATAAGATTAGCGGATCCTACCTGA
ars1 Feature
GACAGAATGGGATACAAGGGCATCGTCTATAATTATAGCTAAAAATTGTATTTTAATTTGTATTTTTTGTAATTTTATTT
CTCATTGTTTTACTTAAAATGAATGCGAATTAGAGAAAACTTCAACGAAATGTCAAAATAAGCTCAGCAAAATATACAAT
TTTAGGGAAAGCGATCAGCAACTTATTCTCCGTTGTAGATTCTTTTTCTTCATAAATTCCAACAACGTAACTGCCAATTG
ATTTTTCTCTAGATGCTAATAAATTGGAACTAATGAGTATAATAACACAGGTTTTGATAAATTGTAAACTCTTACTCAAA
AAAAGAATGTTAAAACTAATTTAACCTTTTTATAAAGGCTCATGGCGTTAAAGAGGATAGTAAAAATTCTACAATTTTTT
AATTTAATGTCGCAATTGTCTTGCGAATATAATTCTATTAATTTTCGCTAACTGCTGTTTTAGTACTATTACTTTCAATA
TGCCTTATATGCAACTTTAATTCATGAAGAATGCAATATTTTTGCAATCTTTCTTGTACTGAGCGCTTTTTATCATTTAG
TACTCATTATTTAATTTTTCAGTAAAGGGCAATAAATAAATTTGTAGAAGATGCAATGTAATCTCCTCTATCCTTTTGCT
CATATATGTTTATGAGTATACCTAGTCTAGAAAGGCTTGTATTTAAAATATTATTCAATAAAAATTCACAATTTTTACGA
CATGTGCTACCATTCACCTAACTTCCTGATTATAAAATTGGTTCGTTTATACTAATTACTTAAGTACCTTTAACTAAACA
AAATGCCTATATATATATTAATTTACAATGAGTGTCAGATAAGTCACTATGTCCGAGTGGTTAAGGAG
attB1 Feature
ACAAGTTTGTACAAAAAAGCAGGCT
attB2 Feature
ACCCAGCTTTCTTGTACAAAGTGGT
attL1 Feature
AGCCTGCTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGT
CAAAATAAAATCATTATTTG
attL2 Feature
ACCCAGCTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGT
CAAAATAAAATCATTATTTG
attP Feature
AAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACACATTGATGAGCAATGCTTTTTTATAATGCCAACT
TTGTACAAAAAAGCTGAACGAGAAACGTAAAATGATATAAATATCAATATATTAAATTAGATTTTGCATAAAAAACAGAC
TACATAATACTGTAAAACACAACATATCCAGTCACTATGAATCAACTACTTAGATGGTATTAGTGACCTGTA
attR1 Feature
ACAAGTTTGTACAAAAAAGCTGAACGAGAAACGTAAAATGATATAAATATCAATATATTAAATTAGATTTTGCATAAAAA
ACAGACTACATAATACTGTAAAACACAACATATCCAGTCACTATG
attR2 Feature
CATAGTGACTGGATATGTTGTGTTTTACAGTATTATGTAGTCTGTTTTTTATGCAAAATCTAATTTAATATATTGATATT
TATATCATTTTACGTTTCTCG
bGlob_int Feature
CGAATCCCGGCCGGGAACGGTGCATTGGAACGCGGATTCCCCGTGCCAAGAGTGACGTAAGTACCGCCTATAGAGTCTAT
AGGCCCACAAAAAATGCTTTCTTCTTTTAATATACTTTTTTGTTTATCTTATTTCTAATACTTTCCCTAATCTCTTTCTT
TCAGGGCAATAATGATACAATGTATCATGCCTCTTTGCACCATTCTAAAGAATAACAGTGATAATTTCTGGGTTAAGGCA
ATAGCAATATTTCTGCATATAAATATTTCTGCATATAAATTGTAACTGATGTAAGAGGTTTCATATTGCTAATAGCAGCT
ACAATCCAGCTACCATTCTGCTTTTATTTTATGGTTGGGATAAGGCTGGATTATTCTGAGTCCAAGCTAGGCCCTTTTGC
TAATCATGTTCATACCTCTTATCTTCCTCCCACAGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGC
AAAGAATTGGGAT
bGlob_int Feature
GTGAGTTTGGGGACCCTTGATTGTTCTTTCTTTTTCGCTATTGTAAAATTCATGTTATATGGAGGGGGCAAAGTTTTCAG
GGTGTTGTTTAGAATGGGAAGATGTCCCTTGTATCACCATGGACCCTCATGATAATTTTGTTTCTTTCACTTTCTACTCT
GTTGACAACCATTGTCTCCTCTTATTTTCTTTTCATTTTCTGTAACTTTTTCGTTAAACTTTAGCTTGCATTTGTAACGA
ATTTTTAAATTCACTTTTGTTTATTTGTCAGATTGTAAGTACTTTCTCTAATCACTTTTTTTTCAAGGCAATCAGGGTAT
ATTATATTGTACTTCAGCACAGTTTTAGAGAACAATTGTTATAATTAAATGATAAGGTAGAATATTTCTGCATATAAATT
CTGGCTGGCGTGGAAATATTCTTATTGGTAGAAACAACTACATCCTGGTCATCATCCTGCCTTTCTCTTTATGGTTACAA
TGATATACACTGTTTGAGATGAGGATAAAATACTCTGAGTCCAAACCGGGCCCCTCTGCTAACCATGTTCATGCCTTCTT
CTTTTTCCTACAG
biotin_Pinpoint_Xa-1 Feature
ATGAAACTGAAGGTAACAGTCAACGGCACTGCGTATGACGTTGACGTTGACGTCGACAAGTCACACGAAAACCCGATGGG
CACCATCCTGTTCGGCGGCGGCACCGGCGGCGCGCCGGCACCGGCAGCAGGTGGCGCAGGCGCCGGTAAGGCCGGAGAGG
GCGAGATTCCCGCTCCGCTGGCCGGCACCGTCTCCAAGATCCTCGTGAAGGAGGGTGACACGGTCAAGGCTGGTCAGACC
GTGCTCGTTCTCGAGGCCATGAAGATGGAGACCGAGATCAACGCTCCCACCGACGGCAAGGTCGAGAAGGTCCTGGTCAA
GGAGCGTGACGCGGTGCAGGGCGGTCAGGGTCTCATCAAGATCGGGGATCTCGAGCTCATCGAAGG
CAP_BS Feature
TTGCTATGCCATAG
ccdB Feature
ATGCAGTTTAAGGTTTACACCTATAAAAGAGAGAGCCGTTATCGTCTGTTTGTGGATGTACAGAGTGATATTATTGACAC
GCCCGGGCGACGGATGGTGATCCCCCTGGCCAGTGCACGTCTGCTGTCAGATAAAGTCTCCCGTGAACTTTACCCGGTGG
TGCATATCGGGGATGAAAGCTGGCGCATGATGACCACCGATATGGCCAGTGTGCCGGTCTCCGTTATCGGGGAAGAAGTG
GCTGATCTCAGCCACCGCGAAAATGACATCAAAAACGCCATTAACCTGATGTTCTGGGGAATATAA
CEN4 Feature
cgctgggccattctcatgaagaatatcttgaatttattgtcatattactagttggtgtggaagtccatatatcggtgatc
aatatagtggttgacatgctggctagtcaacattgagccttttgatcatgcaaatatattacggtattttacaatcaaat
atcaaacttaactattgactttataacttatttaggtggtaacattcttataaaaaagaaaaaaattactgcaaaacagt
actagcttttaacttgtatcctaggttatctatgctgtctcaccatagagaatattacctatttcagaatgtatgtccat
gattcgccgggtaaatacatataatacacaaatctggcttaataaagtctataatatatctcataaagaagtgctaaatt
ggctagtgctatatatttttaagaaaatttcttttgactaagtccatatcgactttgtaaaagttcactttagcatacat
atattacacgagccagaaattgtaacttttgcctaaaatcacaaattgcaaaatttaattgcttgcaaaaggtcacatgc
ttataatcaacttttttaaaaatttaaaatacttttttattttttatttttaaacataaatgaaataatttatttattgt
ttatgattaccgaaacataaaacctgctcaagaaaaagaaactgttttgtccttggaaaaaaagcactacctaggagcgg
ccaaaatgccgaggctttcatagcttaaactctttacagaaaataggcattatagatcagttcgagttttcttattcttc
cttccggttttatcgtcacagttttacagtaaataagtatcacctcttagagt
CEN6_ARS4 Feature
GGTCCTTTTCATCACGTGCTATAAAAATAATTATAATTTAAATTTTTTAATATAAATATATAAATTAAAAATAGAAAGTA
AAAAAAGAAATTAAAGAAAAAATAGTTTTTGTTTTCCGAAGATGTAAAAGACTCTAGGGGGATCGCCAACAAATACTACC
TTTTATCTTGCTCTTCCTGCTCTCAGGTATTAATGCCGAATTGTTTCATCTTGTCTGTGTAGAAGACCACACACGAAAAT
CCTGTGATTTTACATTTTACTTATCGTTAATCGAATGTATATCTATTTAATCTGCTTTTCTTGTCTAATAAATATATATG
TAAAGTACGCTTTTTGTTGAAATTTTTTAAACCTTTGTTTATTTTTTTTTCTTCATTCCGTAACTCTTCTACCTTCTTTA
TTTACTTTCTAAAATCCAAATACAAAACATAAAAATAAATAAACACAGAGTAAATTCCCAAATTATTCCATCATTAAAAG
ATACGAGGCGCGTGTAAGTTACAGGCAAGCGATCCGTCC
chim_int Feature
GTAAGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTGGGCTTGTCGAGACAGAGAAGACTCTTGCGTTT
CTGATAGGCACCTATTGGTCTTACTGACATCCACTTTGCCTTTCTCTCCACAG
cosN Feature
CCGTAACCTGTCGGATCACCGGAAAGGACCCGTAAAGTGATAATGATTATCATCTACATATCACAACGTGCGTGGAGGCC
ATCAAACCAC
cPPT Feature
AAAAGAAAAGGGGGGA
cPPT Feature
AAAAGAAGAGGTAGGA
cPPT Feature
AAAAGAAGGGGAGGAA
cPPT Feature
AAACAAAGGGGTAGAA
cPPT Feature
AAACAAAGGGGTAGAC
CRE_NLS Feature
ATGGCACCCAAGAAGAAGAGGAAGGTGTCCAATTTACTGACCGTACACCAAAATTTGCCTGCATTACCGGTCGATGCAAC
GAGTGATGAGGTTCGCAAGAACCTGATGGACATGTTCAGGGATCGCCAGGCGTTTTCTGAGCATACCTGGAAAATGCTTC
TGTCCGTTTGCCGGTCGTGGGCGGCATGGTGCAAGTTGAATAACCGGAAATGGTTTCCCGCAGAACCTGAAGATGTTCGC
GATTATCTTCTATATCTTCAGGCGCGCGGTCTGGCAGTAAAAACTATCCAGCAACATTTGGGCCAGCTAAACATGCTTCA
TCGTCGGTCCGGGCTGCCACGACCAAGTGACAGCAATGCTGTTTCACTGGTTGTGCGGCGGATCCGAAAAGAAAACGTTG
ATGCCGGTGAACGTGCAAAACAGGCTCTAGCGTTCGAACGCACTGATTTCGACCAGGTTCGTTCACTCATGGAAAATAGC
GATCGCTGCCAGGATATACGTAATCTGGCATTTCTGGGGATTGCTTATAACACCCTGTTACGTATAGCCGAAATTGCCAG
GATCAGGGTTAAAGATATCTCACGTACTGACGGTGGGAGAATGTTAATCCATATTGGCAGAACGAAAACGCTGGTTAGCA
CCGCAGGTGTAGAGAAGGCACTTAGCCTGGGGGTAACTAAACTGGTCGAGCGATGGATTTCCGTCTCTGGTGTAGCTGAT
GATCCGAATAACTACCTGTTTTGCCGGGTCAGAAAAAATGGTGTTGCCGCGCCATCTGCCACCAGCCAGCTATCAACTCG
CGCCCTGGAAGGGATTTTTGAAGCAACTCATCGATTGATTTACGGCGCTAAGGATGACTCTGGTCAGAGATACCTGGCCT
GGTCTGGACACAGTGCCCGTGTCGGAGCCGCGCGAGATATGGCCCGCGCTGGAGTTTCAATACCGGAGATCATGCAAGCT
GGTGGCTGGACCAATGTAAATATTGTCATGAACTATATCCGTAACCTGGATAGTGAAACAGGGGCAATGGTGCGCCTGCT
GCAAGATGGCGATTAG
CX_lead Feature
ATGACCATGATTACGAATTCCCGGGGATCC
delta_U3 Feature
TGGAAGGGCTAATTCACTCCCAACGAAGACAAGATCTGCTTTTTGCTTGTACT
EK Feature
GATGACGACGACAAG
EK Feature
GATGACGATGACAAG
Encap Feature
GTGCGCCGGTGTACACAGGAAGTGACAATTTTCGCGCGGTTTTAGGCGGATGTTGTAGTAAATTTGGGCGTAACCGAGTA
AGATTTGGCCATTTTCGCGGGAAAACTGAATAAGAGGAAGTGAAATCTGAATAATTTTGTGTTACTCAT
FRT Feature
GAAGTTCCTATTCCGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTC
gag Feature
ATGGGCCCGGGCCAGACTGTTACCACTCCCTTAAGTTTGACCTTAGGTCACTGGAAAGATGTCGAGCGGATCGCTCACAA
CCAGTCGGTAGATGTCAAGAAGAGACGTTGGGTTACCTTCTGCTCTGCAGAATGGCCAACCTTTAACGTCGGATGGCCGC
GAGACGGCACCTTTAACCGAGACCTCATCACCCAGGTTAAGATCAAGGTCTTTTCACCTGGCCCGCATGGACACCCAGAC
CAGGTCCCCTACATCGTGACCTGGGAAGCCTTGGCTTTTGACCCCCCTCCCTGGGTCAAGCCCTTTGTACACCCTAAGCC
TCCGCCTCCTCTTCCTCCATCCGCCCCGTCTCTCCCCCTTGAACCTCCTCGTTCGACCCCGCCTCGATCCTCCCTTTATC
CAGCCCTCACTCCTTCTCTAGGCGCCCCCATATGGCCATATGAGATCTTATATGGGGCACCCCCGCCCCTTGTAAACTTC
CCTGACCCTGACATG
Gal4_AD Feature
AATTTTAATCAAAGTGGGAATATTGCTGATAGCTCATTGTCCTTCACTTTCACTAACAGTAGCAACGGTCCGAACCTCAT
AACAACTCAAACAAATTCTCAAGCGCTTTCACAACCAATTGCCTCCTCTAACGTTCATGATAACTTCATGAATAATGAAA
TCACGGCTAGTAAAATTGATGATGGTAATAATTCAAAACCACTGTCACCTGGTTGGACGGACCAAACTGCGTATAACGCG
TTTGGAATCACTACAGGGATGTTTAATACCACTACAATGGATGATGTATATAACTATCTATTCGATGATGAAGATACCCC
ACCAAACCCAAAAAAAGAG
Gal4_AD Feature
ATGGATAAAGCGGAATTAATTCCCGAGCCTCCAAAAAAGAAGAGAAAGGTCGAATTGGGTACCGCCGCCAATTTTAATCA
AAGTGGGAATATTGCTGATAGCTCATTGTCCTTCACTTTCACTAACAGTAGCAACGGTCCGAACCTCATAACAACTCAAA
CAAATTCTCAAGCGCTTTCACAACCAATTGCCTCCTCTAACGTTCATGATAACTTCATGAATAATGAAATCACGGCTAGT
AAAATTGATGATGGTAATAATTCAAAACCACTGTCACCTGGTTGGACGGACCAAACTGCGTATAACGCGTTTGGAATCAC
TACAGGGATGTTTAATACCACTACAATGGATGATGTATATAACTATCTATTCGATGATGAAGATACCCCACCAAACCCAA
AAAAAGAG
Gal4_DBD Feature
ATGAAGCTACTGTCTTCTATCGAACAAGCATGCGATATTTGCCGACTTAAAAAGCTCAAGTGCTCCAAAGAAAAACCGAA
GTGCGCCAAGTGTCTGAAGAACAACTGGGAGTGTCGCTACTCTCCCAAAACCAAAAGGTCTCCGCTGACTAGGGCACATC
TGACAGAAGTGGAATCAAGGCTAGAAAGACTGGAACAGCTATTTCTACTGATTTTTCCTCGAGAAGACCTTGACATGATT
TTGAAAATGGATTCTTTACAGGATATAAAAGCATTGTTAACAGGATTATTTGTACAAGATAATGTGAATAAAGATGCCGT
CACAGATAGATTGGCTTCAGTGGAGACTGATATGCCTCTAACATTGAGACAGCATAGAATAAGTGCGACATCATCATCGG
AAGAGAGTAGTAACAAAGGTCAAAGACAGTTGACTGTATCG
His_patch_thio Feature
ATGGGATCTGATAAAATTATTCATCTGACTGATGATTCTTTTGATACTGATGTACTTAAGGCAGATGGTGCAATCCTGGT
TGATTTCTGGGCACACTGGTGCGGTCCGTGCAAAATGATCGCTCCGATTCTGGATGAAATCGCTGACGAATATCAGGGCA
AACTGACCGTTGCAAAACTGAACATCGATCACAACCCGGGCACTGCGCCGAAATATGGCATCCGTGGTATCCCGACTCTG
CTGCTGTTCAAAAACGGTGAAGTGGCGGCAACCAAAGTGGGTGCACTGTCTAAAGGTCAGTTGAAAGAGTTCCTCGACGC
TAACCTGGC
HIV-1_5_LTR Feature
GGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAG
CTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGT
CAGTGTGGAAAATCTCTAGCA
HIV-1_psi_pack Feature
TGAGTACGCCAAAAATTTTGACTAGCGGAGGCTAGAAGGAGAGAG
HIV_Rev_NES Feature
CTACCACCGCTTGAGAGACTTACTCTTGAT
IgK_secretion Feature
ATGGAGACAGACACACTCCTGCTATGGGTACTGCTGCTCTGGGTTCCAGGTTCCACTGGTGAC
lacY Feature
ATGTACTATTTAAAAAACACAAACTTTTGGATGTTCGGTTTATTCTTTTTCTTTTACTTTTTTATCATGGGAGCCTACTT
CCCGTTTTTCCCGATTTGGCTACATGACATCAACCATATCAGCAAAAGTGATACGGGTATTATTTTTGCCGCTATTTCTC
TGTTCTCGCTATTATTCCAACCGCTGTTTGGTCTGCTTTCTGA
lacZ_a Feature
TTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCC
CTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGG
G
LITR Feature
CATCATCAATAATATACCTTATTTTGGATTGAAGCCAATATGATAATGAGGGGGTGGAGTTTGTGACGTGGCGCGGGGCG
TGGGAACGGGGCGGGTGACGTAG
loxH Feature
ATTACCTCATATAGCATACATTATACGAAGTTAT
loxP Feature
ATAACTTCGTATAGCATACATTATACGAAGTTAT
minicis Feature
ATGTATCGATTAAATAAGGAGGAATAA
modSV40_late_16s_int Feature
GTAAGTTTAGTCTTTTTGTCTTTTATTTCAGGTCCCGGATCCGGTGGTGGTGCAAATCAAAGAACTGCTCCTCAGTGGAT
GTTGCCTTTACTTCTAG
precision Feature
CTGGAAGTTCTGTTCCAGGGG
psi_plus_pack Feature
CCAGCAACTTATCTGTGTCTGTCCGATTGTCTAGTGTCTATGTTTGATGTTATGCGCCTGCGTCTGTACTAGTTAGCTAA
CTAGCTCTGTATCTGGCGGACCCGTGGTGGAACTGACGAGTTCTGAACACCCGGCCGCAACCCTGGGAGACGTCCCAGGG
ACTTTGGGGGCCGTTTTTGTGGCCCGACCTGAGGAAGGGAGTCGATGTGGAATCCGACCCCGTCAGGATATGTGGTTCTG
GTAGGAGACGAGAACCTAAAACAGTTCCCGCCTCCGTCTGAATTTTTGCTTTCGGTTTGGAACCGAAGCCGCGCGTCTTG
TCTGCTGCAGCGCTGCAGCATCGTTCTGTGTTGTCTCTGTCTGACTGTGTTTCTGTATTTGTCTGAAAATTAGGGCCAGA
CTGTTACCACTCCCTTAAGTTTGACCTTAGGTCACTGGAAAGATGTCGAGCGGATCGCTCACAACCAGTCGGTAGATGTC
AAGAAGAGACGTTGGGTTACCTTCTGCTCTGCAGAATGGCCAACCTTTAACGTCGGATGGCCGCGAGACGGCACCTTTAA
CCGAGACCTCATCACCCAGGTTAAGATCAAGGTCTTTTCACCTGGCCCGCATGGACACCCAGACCAGGTCCCCTACATCG
TGACCTGGGAAGCCTTGGCTTTTGACCCCCCTCCCTGGGTCAAGCCCTTTGTACACCCTAAGCCTCCGCCTCCTCTTCCT
CCATCCGCCCCGTCTCTCCCCCTTGAACCTCCTCGTTCGACCCCGCCTCGATCCTCCCTTTATCCAGCCCTCACTCCTTC
TCTAGGCGCC
psi_plus_pack2 Feature
TTGGGGGCTCGTCCGGGATCGGGAGACCCCTGCCCAGGGACCACCGACCCACCACCGGGAGGTAAGCTGGCCAGCAACTT
ATCTGTGTCTGTCCGATTGTCTAGTGTCTATGACTGATTTTATGCGCCTGCGTCGGTACTAGTTAGCTAACTAGCTCTGT
ATCTGGCGGACCCGTGGTGGAACTGACGAGTTCGGAACACCCGGCCGCAACCCTGGGAGACGTCCCAGGGACTTCGGGGG
CCGTTTTTGTGGCCCGACCTGAGTCCAAAAATCCCGATCGTTTTGGACTCTTTGGTGCACCCCCCTTAGAGGAGGGATAT
GTGGTTCTGGTAGGAGACGAGAACCTAAAACAGTTCCCGCCTCCGTCTGAATTTTTGCTTTCGGTTTGGGACCGAAGCCG
CGCCGCGCGTCTTGTCTGCTGCAGCATCGTTCTGTGTTGTCTCTGTCTGACTGTGTTTCTGTATTTGTCTGAAAATATGG
GCCCGGGCCAGACTGTTACCACTCCCTTAAGTTTGACCTTAGGTCACTGGAAAGATGTCGAGCGGATCGCTCACAACCAG
TCGGTAGATGTCAAGAAGAGACGTTGGGTTACCTTCTGCTCTGCAGAATGGCCAACCTTTAACGTCGGATGGCCGCGAGA
CGGCACCTTTAACCGAGACCTCATCACCCAGGTTAAGATCAAGGTCTTTTCACCTGGCCCGCATGGACACCCAGACCAGG
TCCCCTACATCGTGACCTGGGAAGCCTTGGCTTTTGACCCCCCTCCCTGGGTCAAGCCCTTTGTACACCCTAAGCCTCCG
CCTCCTCTTCCTCCATCCGCCCCGTCTCTCCCCCTTGAACCTCCTCGTTCGACCCCGCCTCGATCCTCCCTTTATCCAGC
CCTCACTCCTTCTCTAGGCGCCCCCATATGGCCATATGAGATCTTATATGGGGCACCCCCGCCCCTTGTAAACTTCCCTG
ACCCTGACATGACAAGAGTTACTAACAGCCCCTCTCTCCAAGCTCACTTACAGGCTCTCTACTTAGTCCAGCACGAAGTC
TGGAGACCTCTGGCGGCACGTACCAAGAACAACTGGACCGACCGGTGGTACCTCACCCTTACCGAGTCGGCGACACAGTG
TGGGTCCGCCGACACCAGACTAAGAACCTAGAACCTCGCTGGAAAGGACCTTACACAGTCCTGCTGACCACCCCCACCGC
CCTCAAAGTAGACGGCATCGCAGCTTGGATACACGCCGCCCACGTGAAGGCTGCCGACCCCGGGGGTGGACCATCCTCTA
GACTGCC
RITR Feature
CTACGTCACCCGCCCCGTTCCCACGCCCCGCGCCACGTCACAAACTCCACCCCCTCATTATCATATTGGCTTCAATCCAA
AATAAGGTATATTATTGATGATG
ROP Feature
GTGACCAAACAGGAAAAAACCGCCCTTAACATGGCCCGCTTTATCAGAAGCCAGACATTAACGCTTCTGGAGAAACTCAA
CGAGCTGGACGCGGATGAACAGGCAGACATCTGTGAATCGCTTCACGACCACGCTGATGAGCTTTACCGCAGCTGCCTCG
CGCGTTTCGGTGATGACGGTGAAAACCTCTGA
r_ORF1629 Feature
CGCCCGAAACCAGTACAATAGTTGAGGTGCCGACTGTGTTGCCTGAAAGAGACAATTTGAGCCTAAACCGCCGTCTGCAT
CACCGCCACCACCTCCGCCTCCGCCTCCGCCGCCAGCCCCGCCTGCGCCTCCACCGATGGTAGATTTATCATCAGCTCCA
CCACCGCCGCCATTAGTAGATTTGCCGTCTGAAATGTTACCACCGCCTGCACCATCGCTTTCTAACGTGTTGTCTGAATT
AAAATCGGGCACAGTTAGATTGAAACCCGCCCAAAAACGCCCGCAATCAGAAATAATTCCAAAAAGCTCAACTACAAATT
TGATCGCGGACGTGTTAGCCGACACAATTAATAGGCGTCGTGTGGCTATGGCAAAATCGTCTTCGGAAGCAACTTCTAAC
GACGAGGGTTGGGACGACGACGATAATCGGCCTAATAAAGCTAACACGCCCGATGTTAAATATGTCCAGGCTTTATTTAA
CGTGTTTACGTCGAGTCAATTGTACACTAACGACAGTGATGAAAGAAATACAAAAGCGCATAATATTTTGAACGACGTCG
AACCTTTATTACAAAACAAAACACAAACGAATATCGACAAAGCTAGATTGCTGCTACAAGATTTGGCAAGTTTTGTGGCG
TTGAGCGAAAATCCATTAGATAGTCCAGCCATCGGTTCGGAAAAACAACCCTTGTTTGAAACTAATCGAAACCTATTTTA
CAAATCTATTGAGGATTTAATATTTAAATTCAGATATAAAGACGCTGAAAATCATTTGATTTTCGCTCTAACATACCACC
C
sh_ble Feature
ATGGCCAAGTTGACCAGTGCCGTTCCGGTGCTCACCGCGCGCGACGTCGCCGGAGCGGTCGAGTTCTGGACCGACCGGCT
CGGGTTCTCCCGGGACTTCGTGGAGGACGACTTCGCCGGTGTGGTCCGGGACGACGTGACCCTGTTCATCAGCGCGGTCC
AGGACCAGGTGGTGCCGGACAACACCCTGGCCTGGGTGTGGGTGCGCGGCCTGGACGAGCTGTACGCCGAGTGGTCGGAG
GTCGTGTCCACGAACTTCCGGGACGCCTCCGGGCCGGCCATGACCGAGATCGGCGAGCAGCCGTGGGGGCGGGAGTTCGC
CCTGCGCGACCCGGCCGGCAACTGCGTGCACTTCGTGGCCGAGGAGCAGGACTGA
SV40_3_splice Feature
CCAATTTTTAAGTGTATAATGTGTTAAACTACTGATTCTAATTGTTTGTGTATTTTAGAT
SV40_int Feature
GGTAAATATAAAATTT
SV40_late_19s_int Feature
GTAAGTTTAGTCTTTTTGTCTTTTATTTCAG
SV40_lrgT Feature
GGAACTGATGAATGGGAGCAGTGGTGGAATGCCTTTAATGAGGAAAACCTGTTTTGCTCAGAAGAAATGCCATCTAGTGA
TGATGAGGCTACTGCTGACTCTCAACATTCTACTCCTCCAAAAAAGAAGAGAAAGGTAGAAGACCCCAAGGACTTTCCTT
CAGAATTGCTAAGTTTTTTGAGTCATGCTGTGTTTAGTAATAGAACTCTTGCTTGCTTTGCTATTTACACCACAAAGGAA
AAAGCTGCACTGCTATACAAGAAAATTATGGAAAAATATTCTGTAACCTTTATAAGTAGGCATAACAGTTATAATCATAA
CATACTGTTTTTTCTTACTCCACACAGGCATAGAGTGTCTGCTATTAATAACTATGCTCAAAAATTGTGTACCTTTAGCT
TTTTAATTTGTAAAGGGGTTAATAAGGAATATTTGATGTATAGTGCCTTGACTAGAGATCCATTTTCTGTTATTGAGGAA
AGTTTGCCAGGTGGGTTAAAGGAGCATGATTTTAATCCAGAAGAAGCAGAGGAAACTAAACAAGTGTCCTGGAAGCTTGT
AACAGAGTATGCAATGGAAACAAAATGTGATGATGTGTTGTTATTGCTTGGGATGTACTTGGAATTTCAGTACAGTTTTG
AAATGTGTTTAAAATGTATTAAAAAAGAACAGCCCAGCCACTATAAGTACCATGAAAAGCATTATGCAAATGCTGCTATA
TTTGCTGACAGCAAAAACCAAAAAACCATATGCCAACAGGCTGTTGATACTGTTTTAGCTAAAAAGCGGGTTGATAGCCT
ACAATTAACTAGAGAACAAATGTTAACAAACAGATTTAATGATCTTTTGGATAGGATGGATATAATGTTTGGTTCTACAG
GCTCTGCTGACATAGAAGAATGGATGGCTGGAGTTGCTTGGCTACACTGTTTGTTGCCCAAAATGGATTCAGTGGTGTAT
GACTTTTTAAAATGCATGGTGTACAACATTCCTAAAAAAAGATACTGGCTGTTTAAAGGACCAATTGATAGTGGTAAAAC
TACATTAGCAGCTGCTTTGCTTGAATTATGTGGGGGGAAAGCTTTAAATGTTAATTTGCCCTTGGACAGGCTGAACTTTG
AGCTAGGAGTAGCTATTGACCAGTTTTTAGTAGTTTTTGAGGATGTAAAGGGCACTGGAGGGGAGTCCAGAGATTTGCCT
TCAGGTCAGGGAATTAATAACCTGGACAATTTAAGGGATTATTTGGATGGCAGTGTTAAGGTAAACTTAGAAAAGAAACA
CCTAAATAAAAGAACTCAAATATTTCCCCCTGGAATAGTCACCATGAATGAGTACAGTGTGCCTAAAACACTGCAGGCCA
GATTTGTAAAACAAATAGATTTTAGGCCCAAAGATTATTTAAAGCATTGCCTGGAACGCAGTGAGTTTTTGTTAGAAAAG
AGAATAATTCAAAGTGGCATTGCTTTGCTTCTTATGTTAATTTGGTACAGACCTGTGGCTGAGTTTGCTCAAAGTATTCA
GAGCAGAATTGTGGAGTGGAAAGAGAGATTGGACAAAGAGTTTAGTTTGTCAGTGTATCAAAAAATGAAGTTTAATGTGG
CTATGGGAATTGGAGTTTTAGATTGGCTAAGAAACAGTGATGATGATGATGAAGACAGCCAGGAAAATGCTGATAAAAAT
GAAGATGGTGGGGAGAAGAACATGGAAGACTCAGGGCATGAAACAGGCATTGATTCACAGTCCCAAGGCTCATTTCAGGC
CCCTCAGTCCTCACAGTCTGTTCATGATCATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACCTC
CCACACCTCCCCCTGAACCTGAAACATAA
SV40_NLS Feature
AGCAGCCTGAGGCCTCCTAAGAAGAAGAGGAAGGTT
SV40_NLS Feature
GCGGAATTAATTCCCGAGCCTCCAAAAAAGAAGAGAAAGGTCGAATTGGGTACCGCC
synth_int Feature
GAATTAATTCGCTGTCTGCGAGGGCCAGCTGTTGGGGTGAGTACTCCCTCTCAAAAGCGGGCATGACTTCTGCGCTAAGA
TTGTCAGTTTCCAAAAACGAGGAGGATTTGATATTCACCTGGCCCGCGGTGATGCCTTTGAGGGTGGCCGCGTCCATCTG
GTCAGAAAAGACAATCTTTTTGTTGTCAAGCTTGAGGTGTGGCAGGCTTGAGATCTGGCCATACACTTGAGTGACAATGA
CATCCACTTTGCCTTTCTCTCCACAGGTGTCCACTCCCAGGTCCAACTGCAGGTCG
T7_leader Feature
ATGGCTAGCATGACTGGTGGACAGCAAATGGGT
T7_transl_en_RBS Feature
TTAACTTTAAGAAGGAG
Tn7_att Feature
TGCCCCGCTTACGCAGGGCATCCATTTATTACTCAACCGTAACCGATTTTGCCAGGTTACGCGGC
truncHIV-1_3_LTR Feature
GGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAG
CTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGT
CAGTGTGGAAAATCTCTAGCA
U3PPT Feature
AAAAAAGAAAAAAGGGTGGACTGGGA
U3PPT Feature
AAAAGAAAAAAGGGTGGACTGGGA
U3PPT Feature
AAAAGAAAAGGGGGGACTGGAA
U3PPT Feature
ATAAAAGAAAAAGGGGGACTGCAA
U3PPT Feature
ATAAAAGAAAAGGGGGGACTGGAA
WPRE Feature
aattcccgataatcaacctctggattacaaaatttgtgaaagattgactggtattcttaactatgttgctccttttacgc
tatgtggatacgctgctttaatgcctttgtatcatgctattgcttcccgtatggctttcattttctcctccttgtataaa
tcctggttgctgtctctttatgaggagttgtggcccgttgtcaggcaacgtggcgtggtgtgcactgtgtttgctgacgc
aacccccactggttggggcattgccaccacctgtcagctcctttccgggactttcgctttccccctccctattgccacgg
cggaactcatcgccgcctgccttgcccgctgctggacaggggctcggctgttgggcactgacaattccgtggtgttgtcg
gggaagctgacgtcctttccatggctgctcgcctgtgttgccacctggattctgcgcgggacgtccttctgctacgtccc
ttcggccctcaatccagcggaccttccttcccgcggcctgctgccggctctgcggcctcttccgcgtcttcgccttcgcc
ctcagacgagtcggatctccctttgggccgcctccccgcatcggg
Xpress_EK Feature
GATCTGTACGACGATGACGATAAG
AmpR_promoter Promoter
TTCAAATATGTATCCGCTCATGAGACAAT
ARA_promoter Promoter
CTGACGCTTTTTATCGCAACTCTCTACTG
CaMVd35S_promoter Promoter
CCTGCAGGTCAACATGGTGGAGCACGACACACTTGTCTACTCCAAAAATATCAAAGATACAGTCTCAGAAGACCAAAGGG
CAATTGAGACTTTTCAACAAAGGGTAATATCCGGAAACCTCCTCGGATTCCATTGCCCAGCTATCTGTCACTTTATTGTG
AAGATAGTGGAAAAGGAAGGTGGCTCCTACAAATGCCATCATTGCGATAAAGGAAAGGCCATCGTTGAAGATGCCTCTGC
CGACAGTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACGTCTTCAAAGC
AAGTGGATTGATGTGATAACATGGTGGAGCACGACACACTTGTCTACTCCAAAAATATCAAAGATACAGTCTCAGAAGAC
CAAAGGGCAATTGAGACTTTTCAACAAAGGGTAATATCCGGAAACCTCCTCGGATTCCATTGCCCAGCTATCTGTCACTT
TATTGTGAAGATAGTGGAAAAGGAAGGTGGCTCCTACAAATGCCATCATTGCGATAAAGGAAAGGCCATCGTTGAAGATG
CCTCTGCCGACAGTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACGTCT
TCAAAGCAAGTGGATTGATGTGATATCTCCACTGACGTAAGGGATGACGCACAATCCCACTATCCTTCGCAAGACCCTTC
CTCTATATAAGGAAGTTCATTTCATTTGGAGAGGA
CMV2_promoter Promoter
TAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATCGCCTGGAGACGCCATCCACGCT
GTTTTGACCTCCATAGAAGACACCGGGACCGATCCAGCCT
CMV_immearly_promoter Promoter
ACATTGATTATTGAGTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTA
CATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCC
ATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCA
AGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGA
CCTTATGGGACTTTCCTACTTGGCAGTACATCTACGGTTAGTCATCGCTATTACCATAGTGATGCGGTTTTGGCAGTACA
TCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGG
CACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTG
GGAGGTCTATATAAGCAGAGCTTTCTGGCTAACTAGAGAACCCACTGCTTACTGGC
CMV_promoter Promoter
CGCCCCGTTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGA
TC
EF1a_promoter Promoter
CGTGAGGCTCCGGTGCCCGTCAGTGGGCAGAGCGCACATCGCCCACAGTCCCCGAGAAGTTGGGGGGAGGGGTCGGCAAT
TGAACCGGTGCCTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGATGTCGTGTACTGGCTCCGCCTTTTTCCCGAGGG
TGGGGGAGAACCGTATATAAGTGCAGTAGTCGCCGTGAACGTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTAA
GTGCCGTGTGTGGTTCCCGCGGGCCTGGCCTCTTTACGGGTTATGGCCCTTGCGTGCCTTGAATTACTTCCACCTGGCTG
CAGTACGTGATTCTTGATCCCGAGCTTCGGGTTGGAAGTGGGTGGGAGAGTTCGAGGCCTTGCGCTTAAGGAGCCCCTTC
GCCTCGTGCTTGAGTTGAGGCCTGGCCTGGGCGCTGGGGCCGCCGCGTGCGAATCTGGTGGCACCTTCGCGCCTGTCTCG
CTGCTTTCGATAAGTCTCTAGCCATTTAAAATTTTTGATGACCTGCTGCGACGCTTTTTTTCTGGCAAGATAGTCTTGTA
AATGCGGGCCAAGATCTGCACACTGGTATTTCGGTTTTTGGGGCCGCGGGCGGCGACGGGGCCCGTGCGTCCCAGCGCAC
ATGTTCGGCGAGGCGGGGCCTGCGAGCGCGGCCACCGAGAATCGGACGGGGGTAGTCTCAAGCTGGCCGGCCTGCTCTGG
TGCCTGGCCTCGCGCCGCCGTGTATCGCCCCGCCCTGGGCGGCAAGGCTGGCCCGGTCGGCACCAGTTGCGTGAGCGGAA
AGATGGCCGCTTCCCGGCCCTGCTGCAGGGAGCTCAAAATGGAGGACGCGGCGCTCGGGAGAGCGGGCGGGTGAGTCACC
CACACAAAGGAAAAGGGCCTTTCCGTCCTCAGCCGTCGCTTCATGTGACTCCACGGAGTACCGGGCGCCGTCCAGGCACC
TCGATTAGTTCTCGAGCTTTTGGAGTACGTCGTCTTTAGGTTGGGGGGAGGGGTTTTATGCGATGGAGTTTCCCCACACT
GAGTGGGTGGAGACTGAAGTTAGGCCAGCTTGGCACTTGATGTAATTCTCCTTGGAATTTGCCCTTTTTGAGTTTGGATC
TTGGTTCATTCTCAAGCCTCAGACAGTGGTTCAAAGTTTTTTTCTTCCATTTCAGGTGTCGTGA
EM7_promoter Promoter
GTGTTGACAATTAATCATCGGCATAGTATATCGGCATAGTATAATACGACAAGGTGAGGAACTAAACC
EtoL_promoter Promoter
AAGCCACACTGGACACGAAAAAGTCGAAGGCACTCGCTTCGATCAATGGACAAAGAATCAATCGTTCGTAGGCAACAGAA
TGTCGGAAAGTTTGCATTGGATGCGCGGCGGGTCCAACTTGCCGCAAAACTGCGGCGAGTTCAACGTGGTGTCCAGCCTG
TTGATGTGCAACAATACGATAATGAAAAATTGATAACGCTTGCACGATTGCAAACATGCACGCTCGGTTGAATAAAAGCT
CGCATCGTCGTCGTAAAATTAGTTGTATCAAAGAGCAGCTGCAATTAGAATCACTGCTAAAA
GAL1_promoter Promoter
ACGGATTAGAAGCCGCCGAGCGGGTGACAGCCCTCCGAAGGAAGACTCTCCTCCGTGCGTCCTCGTCTTCACCGGTCGCG
TTCCTGAAACGCAGATGTGCCTCGCGCCGCACTGCTCCGAACAATAAAGATTCTACAATACTAGCTTTTATGGTTATGAA
GAGGAAAAATTGGCAGTAACCTGGCCCCACAAACCTTCAAATGAACGAATCAAATTAACAACCATAGGATGATAATGCGA
TTAGTTTTTTAGCCTTATTTCTGGGGTAATTAATCAGCGAAGCGATGATTTTTGATCTATTAACAGATATATAAATGCAA
AAACTGCATAACCACTTTAACTAATACTTTCAACATTTTCGGTTTGTATTACTTCTTATTCAAATGTAATAAAAGTATCA
ACAAAAAATTGTTAATATACCTCTATACTTTAACGTCAAGGAGAAAAAACC
HS_promoter Promoter
CGCCGGAGTATAAATAGAGGCGCTTCGTCTACGGAGCGACAATTCAATTCAAACAAGCAAAGTGAACACGTCGCTAAGCG
AAAGCTAAGCAAATAAACAAGCGCAGCTGAACAAGCTAAACAATCTGCAGTAAAGTGCAAGTTAAAGTGAATCAATTAAA
AGTAACCAGCAACCAAGTAAATCAACTGCAACTACTGAAATCTGCCAAGAAGTAATTATTGAATACAAGAAGACAACTCT
GAATACTTTCAAAAGTTACCGAGAAAGAAGAACTCA
hU6_promoter Promoter
AAGGTCGGGCAGGAAGAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAAT
TAGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTG
CAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGGTTTATAT
ATCTTGTGGAAAGGACG
hUbC_promoter Promoter
GATCTGGCCTCCGCGCCGGGTTTTGGCGCCCCCCGCGGGCGCCCCCTCCTCACGGCGAGCGCTGCCACGTCAGACGAAGG
GCGCACGAGCGTCCTGATCCTTCCGCCCGGACGCTCAGGACAGCGGCCCGCTGCTCATAAGACTCGGCCTTAGAACCCCA
GTATCAGCAGAAGGACATTTTAGGACGGGACTTGGGTGACTCTAGGGCACTGGTTTTCTTTCCAGAGAGCGGAACAGGCG
AGGAAAAGTAGTCCCTTCTCGGCGATTCTGCGGAGGGATCTCCGTGGGGCGGTGAACGCCGATGATTATATAAGGACGCG
CCGGGTGTGGCACAGCTAGTTCCGTCGCAGCCGGGATTTGGGTCGCGGTTCTTGTTTGTGGATCGCTGTGATCGTCACTT
GGTGAGTAGCGGGCTGCTGGGCTGGCCGGGGCTTTCGTGGCCGCCGGGCCGCTCGGTGGGACGGAAGCGTGTGGAGAGAC
CGCCAAGGGCTGTAGTCTGGGTCCGCGAGCAAGGTTGCCCTGAACTGGGGGTTGGGGGGAGCGCAGCAAAATGGCGGCTG
TTCCCGAGTCTTGAATGGAAGACGCTTGTGAGGCGGGCTGTGAGGTCGTTGAAACAAGGTGGGGGGCATGGTGGGCGGCA
AGAACCCAAGGTCTTGAGGCCTTCGCTAATGCGGGAAAGCTCTTATTCGGGTGAGATGGGCTGGGGCACCATCTGGGGAC
CCTGACGTGAAGTTTGTCACTGACTGGAGAACTCGGTTTGTCGTCTGTTGCGGGGGCGGCAGTTATGGCGGTGCCGTTGG
GCAGTGCACCCGTACCTTTGGGAGCGCGCGCCCTCGTCGTGTCGTGACGTCACCCGTTCTGTTGGCTTATAATGCAGGGT
GGGGCCACCTGCCGGTAGGTGTGCGGTAGGCTTTTCTCCGTCGCAGGACGCAGGGTTCGGGCCTAGGGTAGGCTCTCCTG
AATCGACAGGCGCCGGACCTCTGGTGAGGGGAGGGATAAGTGAGGCGTCAGTTTCTTTGGTCGGTTTTATGTACCTATCT
TCTTAAGTAGCTGAAGCTCCGGTTTTGAACTATGCGCTCGGGGTTGGCGAGTGTGTTTTGTGAAGTTTTTTAGGCACCTT
TTGAAATGTAATCATTTGGGTCAATATGTAATTTTCAGTGTTAGACTAGTAAATTGTCCGCTAAATTCTGGCCGTTTTTG
GCTTTTTTGTTAGAC
lac_promoter Promoter
TTTACACTTTATGCTTCCGGCTCGTATGTT
M13_forward20_primer Promoter
GTAAAACGACGGCCAGT
M13_reverse_primer Promoter
GGAAACAGCTATGACCATG
NEOKAN_promoter Promoter
CCGGAATTGCCAGCTGGGGCGCCCTCTGGTAAGGTTGGGAAGCCCTGCAA
NMT_promoter Promoter
AGACAGAATAAGTCATCAGCGGTTGTTTCATTTCCTATATTTTTTTTTTATTTTTTTATTTTTTAATAAGGGAAAATTTA
ACGTCTAAGGATACAGAAGATTGTTAGCACATTAAAGTAATAAAGGCTTAAGTAGTAAGTGCCTTAGCATGTTATTGTAT
TTCAAAGGACATAATCTAAAATAATAACAATATCGTTTCTCACAAGTTATTCAATTTTCTTTTTTTTTTCTAATAATATC
AAGAATGTATTATTTGTTTGACATAAGTCAACTAATTTATTTAATATGCTGGATTAATCTTGCAGACATGTAAATTAACA
AGTTTTAGTCAAATAACGTCGAAGTTTCAATGAACTCAAATAATTTCTCTTTTTTTTTATATAACCATAATCTGATTTAT
ATTTTCCGCAGGGATCAACTGGAGTTATGACATTTGGATTGGATCACTTATAACCTTGGTCGCCAAATAATACAAAAATC
AGCGTTATAAAACAAAGAAGGTTTTTGTTAAGAAATTAATCCTCTTTCTTGATAAGAAAGTTGAACCGAAATTGCAGATA
CTGATATATGAAAATAATACCCACAATTTTGGGAATAGCGCAAGCCTCAATTTAAACAATAGGTGAGGACACATGATAAT
GACCTCAATGATTGTTAGAAGAAAAGAGCCTCATTACAAAATCGAAAAATGAATGGTTGGGTACAAGTTTCCAAAACATG
GTAAAGTGGACTTTGCGTATGAGACGTAAATAGAAAAAAACACTTGTTATATGTTTTCTAGAATTATTGTTGTCTCTTTA
TGGTTGGATGATGCAAAATAGTAATTTCGGTTAGTTGCTGTAAAACACCACGAGACAAATAGATATGGATATTTATTAAA
TCAGGAAAAACGTAACTCTCGGCTACTGGATGGTTCAGTCACCCAACGATTACTGGGGAGAGAAAACAGGGCAAAAGCAA
AGCTTAAAGGAATCCGATTGTCATTCGGCAATGTGCAGCGAAACTAAAAACCGGATAATGGACCTGTTAATCGAAACATT
GAAGATATATAAAGGAAGAGGAATCCTGGCATATCATCAATTGAATAAGTTGAATTAATTATTTCAATCTCATTCTCACT
TTCTGACTTATAGTCGCT
P5_promoter Promoter
GCTTTCCTGGCTTTGCTTCCAGATGTATGCT
PH_promoter Promoter
AGTTGCTGATATCATGGAGATAATTAAAATGATAACCATCTCGCAAATAAATAAGTATTTTACTGTTTTCGTAACAGTTT
TGTAATAAAAAAACCTATAAA
PL_promoter Promoter
TCTCACCTACCAAACAATGCCCCCCTGCAAAAAATAAATTCATATAAAAAACATACAGATAACCATCTGCGGTGATAAAT
TATCTCTGGCGGTGTTGACATAAATACCACTGGCGGTGATACTGAGCACATCAGCAGGACGCACTGACCACCATGAAGGT
GACGCTCTTAAAATTAAGCCCTGAAGAAGGGCAGCATTCAAAGCAGAAGGCTTTGGGGTGTGTGATACGAAACGAAGCAT
TGG
RSV_promoter Promoter
CTGCTCCCTGCTTGTGTGTTGGAGGTCGCTGAGTAGTGCGCGAGCAAAATTTAAGCTACAACAAGGCAAGGCTTGACCGA
CAATTGCATGAAGAATCTGCTTAGGGTTAGGCGTTTTGCGCTGCTTCGCGATGTACGGGCCAGATATACGCGTATCTGAG
GGGACTAGGGTGTGTTTAGGCGAAAAGCGGGGCTTCGGTTGTACGCGGTTAGGAGTCCCCTCAGGATATAGTAGTTTCGC
TTTTGCATAGGGAGGGGGAAATGTAGTCTTATGCAATACTCTTGTAGTCTTGCAACATGGTAACGATGAGTTAGCAACAT
GCCTTACAAGGAGAGAAAAAGCACCGTGCATGCCGATTGGTGGAAGTAAGGTGGTACGATCGTGCCTTATTAGGAAGGCA
ACAGACGGGTCTGACATGGATTGGACGAACCACTGAATTCCGCATTGCAGAGATATTGTATTTAAGTGCCTAGCTCGATA
CAATAAACGCCATTTGACCATTCACCACATTGGTGTGCACC
Sp6_promoter Promoter
CATTTAGGTGACACTATA
SV40_promoter Promoter
GGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCAGGTGTGGA
AAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCATAGTCCCGCCCCTAAC
TCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATGCAG
AGGCCGAGGCCGCCTCGGCCTCTGAGCTA
SV40_promoter Promoter
TGCATCTCAATTAGTCAGCAACCATAGTCCCGCCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCAT
TCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCGGCCTCTGAGCTATTCCAGAAGTA
GTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTGCAAAAAGCTT
T3_promoter Promoter
AATTAACCCTCACTAAAGGG
T7_promoter Promoter
TAATACGACTCACTATAGG
tac_promoter Promoter
TGACAATTAATCATCGGCTCGTATAATGT
TATA_promoter Promoter
GCCGCCCCGACTGCATCTGCGTGTTCGAATTCGCCAATGACAAGACGCTGGGCGGGGTTTGTGTCATCATAGAACTAAAG
ACATGCAAATATATTTCTTCCGGGGACACCGCCAGCAAACGCGAGCAACGGGCCACGGGGATGAAGCAG
TK_promoter Promoter
CCTGCTTCATCCCCGTGGCCCGTTGCTCGCGTTTGCTGGCGGTGTCCCCGGAAGAAATATATTTGCATGTCTTTAGTTCT
ATGATGACACAAACCCCGCCCAGCGTCTTGTCATTGGCGAATTCGAACACGCAGATGCAGTCGGGGCGGCGCGGTCCGAG
GTCCACTTCGCATATTAAGGTGACGCGTGTGGCCTCGAACACCGAGCGACCCTGCAGCGACCCGCTTAACAGCGTCAACA
GCGTGCCGCAGATCCCGGGGGGC
trc_promoter Promoter
TTGACAATTAATCATCCGGTCCGTATAATCTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGACC
URA3_promoter Promoter
TAGCTTTTCAATTCAATTCATCATTTTTTTTTTATTCTTTTTTTTGATTTCGGTTTCTTTGAAATTTTTTTGATTCGGTA
ATCTCCGAACAGAAGGAAGAACGAAGGAAGGAGCACAGACTTAGATTGGTATATATACGCATATGTAGTGTTGAAGAAAC
ATGAAATTGCCCAGTATTCTTAACCCAACTGCACAGAACAAAAACCTGCAGGAAACGAAGATAAAT
yADH1_promoter Promoter
CAACTTCTTTTCTTTTTTTTTCTTTTCTCTCTCCCCCGTTGTTGTCTCACCATATCCGCAATGACAAAAAAATGATGGAA
GACACTAAAGGAAAAAATTAACGACAAAGACAGCACCAACAGATGTCGTTGTTCCAGAGCTGATGAGGGGTATCTCGAAG
CACACGAAACTTTTTCCTTCCTTCATTCACGCACACTACTCTCTAATGAGCAACGGTATACGGCCTTCCTTCCAGTTACT
TGAATTTGAAATAAAAAAAAGTTTGCTGTCTTGCTATCAAGTATAAATAGACCTGCAATTATTAATCTTTTGTTTCCTCG
TCATTGTTCTCGTTCCCTTTCTTCCTTGTTTCTTTTTCTGCACAATATTTCAAGCTATACCAAGCATACAATCAACT
3_AOX1_primer Primer
GCAAATGGCATTCTGACATCC
5_AOX1_primer Primer
GACTGGTCCAATTGACAAGC
AC5_primer Primer
ACACAAAGCCGCTCCATCAG
alpha_factor_primer Primer
TACTATTGCCAGCATTGCTGC
AUG1_fwd_primer Primer
CAATTTACATCTTTATTTATTAACG
AUG1_rev_primer Primer
GAAGAGAAAAACATTAGTTGGC
Baculovirs_rev_primer Primer
ACTTCAAGGAGAATTTCC
BGH_rev_primer Primer
TAGAAGGCACAGTCGAGG
cI_fwd_primer Primer
GGATAGCCGGTCAGGTGTT
CMV_fwd_primer Primer
CGCAAATGGGCGGTAGGCGTG
CYC1_primer Primer
GCGTGAATGTAAGCGTGAC
dsRed1_C_primer Primer
AGCTGGACATCACCTCCCACAACG
dsRed1_N_primer Primer
GTACTGGAACTGGGGGGACAG
EBV_rev_primer Primer
GTGGTTTGTCCAAACTCATC
Ecdysone_fwd_primer Primer
CTCTGAATACTTTCAACAAGTTAC
EF1a_fwd_primer Primer
TCAAGCCTCAGACAGTGGTTC
EGFP_C_primer Primer
CATGGTCCTGCTGGAGTTCGTG
EGFP_N_primer Primer
CGTCGCCGTCCAGCTCGACCAG
Gal10Pro_F_primer Primer
GGTGGTAATGCCATGTAATATG
GAL1_primer Primer
AATATACCTCTATACTTTAACGTC
Gal4_AD_primer Primer
AATACCACTACAATGGAT
Gal4_N_term_primer Primer
GAGTAGTAACAAAGGTCAA
GFPfusionREV_primer Primer
CTCCACTGACAGAAAATTTG
GFP_F_primer Primer
GGTCCTTCTTGAGTTTGTAAC
GFP_R_primer Primer
CCATCTAATTCAACAAGAATTGGGACAAC
GPDPro_F_primer Primer
CGGTAGGTATTGATTGTAATTCTG
H1_primer Primer
TCGCTATGTGTTCTGGGAAA
HAT_primer Primer
GAGGAGCACGCTCATGCCCAC
HA_primer Primer
ATGTACCCATACCATGTTCCAGATTAC
LKO1_5_primer Primer
GACTATCATATGCTTACCGT
LNCX_primer Primer
AGCTCGTTTAGTGAACCGTCAGATC
LucNrev_primer Primer
CCTTATGCAGTTGCTCTCC
M13_pUC_fwd_primer Primer
CCCAGTCACGACGTTGTAAAACG
M13_pUC_rev_primer Primer
AGCGGATAACAATTTCACACAGG
MBP_F_primer Primer
GATGAAGCCCTGAAAGACGCGCAG
Metallothionein_primer Primer
CATCTCAGTGCAACTAAA
mPGK_F_primer Primer
CATTCTGCACGCTTCAAAAG
MSCV_primer Primer
CCCTTGAACCTCCTCGTTCGACC
MSCV_rev_primer Primer
CAGCGGGGCTGCTAAAGCGCATGC
Myc_primer Primer
GCATCAATGCAGAAGCTGATCTCA
OpIE2_fwd_primer Primer
CGCAACGATCTGGTAAACAC
pBABE_3_primer Primer
ACCCTAACTGACACACATTCC
pBABE_5_primer Primer
CTTTATCCAGCCCTCAC
pBAD_fwd_primer Primer
ATGCCATAGCATTTTTATCC
pBAD_rev_primer Primer
GATTTAATCTGTATCAGG
pBluescriptKS_primer Primer
TCGAGGTCGACGGTATC
pBluescriptSK_primer Primer
TCTAGAACTAGTGGATC
pBMN_5_primer Primer
GCTTGGATACACGCCGC
pBRrevBam_primer Primer
GGTGATGTCGGCGATATAGG
pCAG_F_primer Primer
GCAACGTGCTGGTTATTGTG
pCEP_fwd_primer Primer
AGAGCTCGTTTAGTGAACCG
pCMV_primer Primer
GATCCGGTACTAGAGGAACTGAAAAAC
pGAP_primer Primer
GTCCCTATTTCAATCAATTGAA
pGENE_fwd_primer Primer
CTGCTATTCTGCTCAACCT
pGEX_3_primer Primer
CCGGGAGCTGCATGTGTCAGAGG
pHybLex_fwd_primer Primer
AGGGCTGGCGGTTGGGGTTATTCGC
pHybLex_rev_primer Primer
GAGTCACTTTAAAATTTGTATACAC
pJG4_5_fwd_primer Primer
GATGCCTCCTACCCTTATGATGTGCC
pJG4_5_rev_primer Primer
GGAGACTTGACCAAACCTCTGGCG
pLXSN_5_primer Primer
CCCTTGAACCTCCTCGTTCGACC
polyhedrinn_rev_primer Primer
GTCCAAGTTTCCCTG
polyhedrin_fwd_primer Primer
AAATGATAACCATCTCGC
pREP_fwd_primer Primer
GCTCGATACAATAAACGCC
pRH_fwd_primer Primer
CTGTCTCTATACTCCCCTATAG
pRH_rev_primer Primer
CAAAATTCAATAGTTACTATCGC
pTrcHis_fwd_primer Primer
GAGGTATATATTAATGTATCG
pTrcHis_rev_primer Primer
GATTTAATCTGTATCAGG
pUni_fwd_primer Primer
CTATCAACAGGTTGAACTG
pUni_rev_primer Primer
CAGTCGAGGCTGATAGCGAGCT
pYESTrp_fwd_primer Primer
GATGTTAACGATACCAGCC
pYESTrp_rev_primer Primer
GCGTGAATGTAAGCGTGAC
RVprimer3_primer Primer
CTAGCAAAATAGGCTGTCCC
Sp6_primer Primer
ATTTAGGTGACACTATAG
SV40pro_F_primer Primer
TATTTATGCAGAGGCCGAGG
T7_Terminal_primer Primer
GCTAGTTATTGCTCAGCGG
V5_rev_primer Primer
ACCGAGGAGAGGGTTAGGAT
Xpress_fwd_primer Primer
TATGGCTAGCATGACTGGT
AatII Enzyme
GACGTC
Acc65I Enzyme
GGTACC
AccI Enzyme
GTAGAC
AccI Enzyme
GTATAC
AccI Enzyme
GTCGAC
AccI Enzyme
GTCTAC
AclI Enzyme
AACGTT
AfeI Enzyme
AGCGCT
AflII Enzyme
CTTAAG
AgeI Enzyme
ACCGGT
ApaI Enzyme
GGGCCC
ApaLI Enzyme
GTGCAC
ApoI Enzyme
AAATTC
ApoI Enzyme
AAATTT
ApoI Enzyme
GAATTC
ApoI Enzyme
GAATTT
AscI Enzyme
GGCGCGCC
AseI Enzyme
ATTAAT
AsiSI Enzyme
GCGATCGC
AvrII Enzyme
CCTAGG
BamHI Enzyme
GGATCC
BclI Enzyme
TGATCA
BglII Enzyme
AGATCT
Bme1580I Enzyme
GGGCAC
Bme1580I Enzyme
GGGCCC
Bme1580I Enzyme
GTGCAC
Bme1580I Enzyme
GTGCCC
BmtI Enzyme
GCTAGC
BsaHI Enzyme
GACGCC
BsaHI Enzyme
GACGTC
BsaHI Enzyme
GGCGCC
BsaHI Enzyme
GGCGTC
BsiEI Enzyme
CGACCG
BsiEI Enzyme
CGATCG
BsiEI Enzyme
CGGCCG
BsiEI Enzyme
CGGTCG
BsiWI Enzyme
CGTACG
BspEI Enzyme
TCCGGA
BspHI Enzyme
TCATGA
BsrGI Enzyme
TGTACA
BssHII Enzyme
GCGCGC
BstBI Enzyme
TTCGAA
BstZ17I Enzyme
GTATAC
BtgI Enzyme
CCACGG
BtgI Enzyme
CCATGG
BtgI Enzyme
CCGCGG
BtgI Enzyme
CCGTGG
ClaI Enzyme
ATCGAT
DraI Enzyme
TTTAAA
EaeI Enzyme
CGGCCA
EaeI Enzyme
CGGCCG
EaeI Enzyme
TGGCCA
EaeI Enzyme
TGGCCG
EagI Enzyme
CGGCCG
EcoRI Enzyme
GAATTC
EcoRV Enzyme
GATATC
FseI Enzyme
GGCCGGCC
FspI Enzyme
TGCGCA
HaeII Enzyme
AGCGCC
HaeII Enzyme
AGCGCT
HaeII Enzyme
GGCGCC
HaeII Enzyme
GGCGCT
HincII Enzyme
GTCAAC
HincII Enzyme
GTCGAC
HincII Enzyme
GTTAAC
HincII Enzyme
GTTGAC
HindIII Enzyme
AAGCTT
HpaI Enzyme
GTTAAC
KasI Enzyme
GGCGCC
KpnI Enzyme
GGTACC
MfeI Enzyme
CAATTG
MluI Enzyme
ACGCGT
MscI Enzyme
TGGCCA
MspA1I Enzyme
CAGCGG
MspA1I Enzyme
CAGCTG
MspA1I Enzyme
CCGCGG
MspA1I Enzyme
CCGCTG
NaeI Enzyme
GCCGGC
NarI Enzyme
GGCGCC
NcoI Enzyme
CCATGG
NdeI Enzyme
CATATG
NgoMIV Enzyme
GCCGGC
NheI Enzyme
GCTAGC
NotI Enzyme
GCGGCCGC
NruI Enzyme
TCGCGA
NsiI Enzyme
ATGCAT
NspI Enzyme
ACATGC
NspI Enzyme
ACATGT
NspI Enzyme
GCATGC
NspI Enzyme
GCATGT
PacI Enzyme
TTAATTAA
PciI Enzyme
ACATGT
PmeI Enzyme
GTTTAAAC
PmlI Enzyme
CACGTG
PsiI Enzyme
TTATAA
PspOMI Enzyme
GGGCCC
PstI Enzyme
CTGCAG
PvuI Enzyme
CGATCG
PvuII Enzyme
CAGCTG
SacI Enzyme
GAGCTC
SacII Enzyme
CCGCGG
SalI Enzyme
GTCGAC
SbfI Enzyme
CCTGCAGG
ScaI Enzyme
AGTACT
SfcI Enzyme
CTACAG
SfcI Enzyme
CTATAG
SfcI Enzyme
CTGCAG
SfcI Enzyme
CTGTAG
SfoI Enzyme
GGCGCC
SgrAI Enzyme
CACCGGCG
SgrAI Enzyme
CACCGGTG
SgrAI Enzyme
CGCCGGCG
SgrAI Enzyme
CGCCGGTG
SmaI Enzyme
CCCGGG
SmlI Enzyme
CTCAAG
SmlI Enzyme
CTCGAG
SmlI Enzyme
CTTAAG
SmlI Enzyme
CTTGAG
SnaBI Enzyme
TACGTA
SpeI Enzyme
ACTAGT
SphI Enzyme
GCATGC
SspI Enzyme
AATATT
StuI Enzyme
AGGCCT
SwaI Enzyme
ATTTAAAT
XbaI Enzyme
TCTAGA
XhoI Enzyme
CTCGAG
XmaI Enzyme
CCCGGG
AcGFP1 Gene
GTGAGCAAGGGCGCCGAGCTGTTCACCGGCATCGTGCCCATCCTGATCGAGCTGAATGGCGATGTGAATGGCCACAAGTT
CAGCGTGAGCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGC
CTGTGCCCTGGCCCACCCTGGTGACCACCCTGAGCTACGGCGTGCAGTGCTTCTCACGCTACCCCGATCACATGAAGCAG
CACGACTTCTTCAAGAGCGCCATGCCTGAGGGCTACATCCAGGAGCGCACCATCTTCTTCGAGGATGACGGCAACTACAA
GTCGCGCGCCGAGGTGAAGTTCGAGGGCGATACCCTGGTGAATCGCATCGAGCTGACCGGCACCGATTTCAAGGAGGATG
GCAACATCCTGGGCAATAAGATGGAGTACAACTACAACGCCCACAATGTGTACATCATGACCGACAAGGCCAAGAATGGC
ATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGATGGCAGCGTGCAGCTGGCCGACCACTACCAGCAGAATACCCC
CATCGGCGATGGCCCTGTGCTGCTGCCCGATAACCACTACCTGTCCACCCAGAGCGCCCTGTCCAAGGACCCCAACGAGA
AGCGCGATCACATGATCTACTTCGGCTTCGTGACCGCCGCCGCCATCACCCACGGCATGGATGAGCTGTACAAG
AmCyan1 Gene
gctctttcaaacaagtttatcggagatgacatgaaaatgacctaccatatggatggctgtgtcaatgggcattactttac
cgtcaaaggtgaaggcagcgggaagccatacgaagggacgcagacctcgacttttaaagtcaccatggccaacggtgggc
cccttgcattctcctttgacatactatctacagtgttcatgtatggaaatcgatgctttactgcgtatcctaccagtatg
cccgactatttcaaacaagcatttcctgacggaatgtcatatgaaaggacttttacctatgaagatggaggagttgctac
agccagttgggaaataagccttaaaggcaactgctttgagcacaaatccacgtttcatggagtgaactttcctgctgatg
gacctgtgatggcgaagatgacaactggttgggacccatcttttgagaaaatgactgtctgcgatggaatattgaagggt
gatgtcaccgcgttcctcatgctgcaaggaggtggcaattacagatgccaattccacacttcttacaagacaaaaaaacc
ggtgacgatgccaccaaaccatgcggtggaacatcgcattgcgaggaccgaccttgacaaaggtggcaacagtgttcagc
tgacggagcacgctgttgcacatataacctctgttgtccctttc
Ampicillin Gene
ATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAAC
GCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGA
TCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCC
CGTGTTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCAC
AGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCA
ACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTT
GATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAAC
GTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAG
TTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCT
CGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAAC
TATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAA
AsRed2 Gene
gcctctttgctgaagaagaccatgcccttcaggaccaccatcgagggcaccgtgaacggccactacttcaagtgcaccgg
caagggcgagggcaaccccctggagggcacccaggagatgaagatcgaggtgatcgagggcggccccctgcccttcgcct
tccacatcctgtccacctcctgcatgtacggctccaaggccttcatcaagtacgtgtccggcatccccgactacttcaag
cagtccctccccgagggcttcacctgggagcgcaccaccacctacgaggacggcggcttcctgaccgcccaccaggacac
ctccctggacggcgactgcctggtgtacaaggtgaagatcctgggcaacaacttccccgccgacggccccgtgatgcaga
acaaggccggccgctgggagccctccaccgagatcgtgtacgaggtggacggcgtgctgcgcggccagtccctgatggcc
ctggagtgccccggcggtcgccacctgacctgccacctgcacaccacctaccgctccaagaagcccgcctccgccctgaa
gatgcccggcttccacttcgaggaccaccgcatcgagatcctggaggaggtggagaagggcaagtgctacaagcagtacg
aggccgccgtgggccgctactgcgacgccgccccctccaagctgggccacaactccggactcagatctcgagctcaagct
tcgaattctgcagtcgacggtaccgcgggcccgggatccaccggatctaga
blast Gene
ATGGCCAAGCCTTTGTCTCAAGAAGAATCCACCCTCATTGAAAGAGCAACGGCTACAATCAACAGCATCCCCATCTCTGA
AGACTACAGCGTCGCCAGCGCAGCTCTCTCTAGCGACGGCCGCATCTTCACTGGTGTCAATGTATATCATTTTACTGGGG
GACCTTGTGCAGAACTCGTGGTGCTGGGCACTGCTGCTGCTGCGGCAGCTGGCAACCTGACTTGTATCGTCGCGATCGGA
AATGAGAACAGGGGCATCTTGAGCCCCTGCGGACGGTGTCGACAGGTGCTTCTCGATCTGCATCCTGGGATCAAAGCGAT
AGTGAAGGACAGTGATGGACAGCCGACGGCAGTTGGGATTCGTGAATTGCTGCCCTCTGGTTATGTGTGGGAGGGCTAA
bleo Gene
ATGGCCAAGTTGACCAGTGCCGTTCCGGTGCTCACCGCGCGCGACGTCGCCGGAGCGGTCGAGTTCTGGACCGACCGGCT
CGGGTTCTCCCGGGACTTCGTGGAGGACGACTTCGCCGGTGTGGTCCGGGACGACGTGACCCTGTTCATCAGCGCGGTCC
AGGACCAGGTGGTGCCGGACAACACCCTGGCCTGGGTGTGGGTGCGCGGCCTGGACGAGCTGTACGCCGAGTGGTCGGAG
GTCGTGTCCACGAACTTCCGGGACGCCTCCGGGCCGGCCATGACCGAGATCGGCGAGCAGCCGTGGGGGCGGGAGTTCGC
CCTGCGCGACCCGGCCGGCAACTGCGTGCACTTCGTGGCCGAGGAGCAGGAC
CAT/CamR Gene
ATGGAGAAAAAAATCACTGGATATACCACCGTTGATATATCCCAATGGCATCGTAAAGAACATTTTGAGGCATTTCAGTC
AGTTGCTCAATGTACCTATAACCAGACCGTTCAGCTGGATATTACGGCCTTTTTAAAGACCGTAAAGAAAAATAAGCACA
AGTTTTATCCGGCCTTTATTCACATTCTTGCCCGCCTGATGAATGCTCATCCGGAATTACGTATGGCAATGAAAGACGGT
GAGCTGGTGATATGGGATAGTGTTCACCCTTGTTACACCGTTTTCCATGAGCAAACTGAAACGTTTTCATCGCTCTGGAG
TGAATACCACGACGATTTCCGGCAGTTTCTACACATATATTCGCAAGATGTGGCGTGTTACGGTGAAAACCTGGCCTATT
TCCCTAAAGGGTTTATTGAGAATATGTTTTTCGTCTCAGCCAATCCCTGGGTGAGTTTCACCAGTTTTGATTTAAACGTG
GCCAATATGGACAACTTCTTCGCCCCCGTTTTCACCATGGGCAAATATTATACGCAAGGCGACAAGGTGCTGATGCCGCT
GGCGATTCAGGTTCATCATGCCGTTTGTGATGGCTTCCATGTCGGCAGAATGCTTAATGAATTACAACAGTACTGCGATG
AGTGGCAGGGCGGGGCGTAA
DsRed1 Gene
GTGCGCTCCTCCAAGAACGTCATCAAGGAGTTCATGCGCTTCAAGGTGCGCATGGAGGGCACCGTGAACGGCCACGAGTT
CGAGATCGAGGGCGAGGGCGAGGGCCGCCCCTACGAGGGCCACAACACCGTGAAGCTGAAGGTGACCAAGGGCGGCCCCC
TGCCCTTCGCCTGGGACATCCTGTCCCCCCAGTTCCAGTACGGCTCCAAGGTGTACGTGAAGCACCCCGCCGACATCCCC
GACTACAAGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTTCGAGGACGGCGGCGTGGTGACCGT
GACCCAAGACTCCTCCCTGCAGGACGGCTGCTTCATCTACAAGGTGAAGTTCATCGGCGTGAACTTCCCCTCCGACGGCC
CCGTAATGCAGAAGAAGACCATGGGCTGGGAGGCCTCCACCGAGCGCCTGTACCCCCGCGACGGCGTGCTGAAGGGCGAG
ATCCACAAGGCCCTGAAGCTGAAGGACGGCGGCCACTACCTGGTGGAGTTCAAGTCCATCTACATGGCCAAGAAGCCCGT
GCAGCTGCCCGGCTACTACTACGTGGACTCCAAGCTGGACATCACCTCCCACAACGAGGACTACACCATCGTGGAGCAGT
ACGAGCGCACCGAGGGCCGCCACCACCTGTTCCTG
DsRed2 Gene
GCCTCCTCCGAGAACGTCATCACCGAGTTCATGCGCTTCAAGGTGCGCATGGAGGGCACCGTGAACGGCCACGAGTTCGA
GATCGAGGGCGAGGGCGAGGGCCGCCCCTACGAGGGCCACAACACCGTGAAGCTGAAGGTGACCAAGGGCGGCCCCCTGC
CCTTCGCCTGGGACATCCTGTCCCCCCAGTTCCAGTACGGCTCCAAGGTGTACGTGAAGCACCCCGCCGACATCCCCGAC
TACAAGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTTCGAGGACGGCGGCGTGGCGACCGTGAC
CCAGGACTCCTCCCTGCAGGACGGCTGCTTCATCTACAAGGTGAAGTTCATCGGCGTGAACTTCCCCTCCGACGGCCCCG
TGATGCAGAAGAAGACCATGGGCTGGGAGGCCTCCACCGAGCGCCTGTACCCCCGCGACGGCGTGCTGAAGGGCGAGACC
CACAAGGCCCTGAAGCTGAAGGACGGCGGCCACTACCTGGTGGAGTTCAAGTCTATCTACATGGCCAAGAAGCCCGTGCA
GCTGCCCGGCTACTACTACGTGGACGCCAAGCTGGACATCACCTCCCACAACGAGGACTACACCATCGTGGAGCAGTACG
AGCGCACCGAGGGCCGCCACCACCTGTTCCTG
DsRed_Express Gene
GCCTCCTCCGAGGACGTCATCAAGGAGTTCATGCGCTTCAAGGTGCGCATGGAGGGCTCCGTGAACGGCCACGAGTTCGA
GATCGAGGGCGAGGGCGAGGGCCGCCCCTACGAGGGCACCCAGACCGCCAAGCTGAAGGTGACCAAGGGCGGCCCCCTGC
CCTTCGCCTGGGACATCCTGTCCCCCCAGTTCCAGTACGGCTCCAAGGTGTACGTGAAGCACCCCGCCGACATCCCCGAC
TACAAGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTTCGAGGACGGCGGCGTGGTGACCGTGAC
CCAGGACTCCTCCCTGCAGGACGGCTCCTTCATCTACAAGGTGAAGTTCATCGGCGTGAACTTCCCCTCCGACGGCCCCG
TAATGCAGAAGAAGACTATGGGCTGGGAGGCCTCCACCGAGCGCCTGTACCCCCGCGACGGCGTGCTGAAGGGCGAGATC
CACAAGGCCCTGAAGCTGAAGGACGGCGGCCACTACCTGGTGGAGTTCAAGTCCATCTACATGGCCAAGAAGCCCGTGCA
GCTGCCCGGCTACTACTACGTGGACTCCAAGCTGGACATCACCTCCCACAACGAGGACTACACCATCGTGGAGCAGTACG
AGCGCGCCGAGGGCCGCCACCACCTGTTCCTG
DsRed_Express_2 Gene
ATGGCCTCCTCCGAGGACGTCATCAAGGAGTTCATGCGCTTCAAGGTGCGCATGGAGGGCTCCGTGAACGGCCACGAGTT
CGAGATCGAGGGCGAGGGCGAGGGCCGCCCCTACGAGGGCACCCAGACCGCCAAGCTGAAGGTGACCAAGGGCGGCCCCC
TGCCCTTCGCCTGGGACATCCTGTCCCCCCAGTTCCAGTACGGCTCCAAGGTGTACGTGAAGCACCCCGCCGACATCCCC
GACTACAAGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTTCGAGGACGGCGGCGTGGTGACCGT
GACCCAGGACTCCTCCCTGCAGGACGGCTCCTTCATCTACAAGGTGAAGTTCATCGGCGTGAACTTCCCCTCCGACGGCC
CCGTAATGCAGAAGAAGACTATGGGCTGGGAGGCCTCCACCGAGCGCCTGTACCCCCGCGACGGCGTGCTGAAGGGCGAG
ATCCACAAGGCCCTGAAGCTGAAGGACGGCGGCCACTACCTGGTGGAGTTCAAGTCCATCTACATGGCCAAGAAGCCCGT
GCAGCTGCCCGGCTACTACTACGTGGACTCCAAGCTGGACATCACCTCCCACAACGAGGACTACACCATCGTGGAGCAGT
ACGAGCGCGCCGAGGGCCGCCACCACCTGTTCCTGTAG
DsRed_Monomer Gene
GACAACACCGAGGACGTCATCAAGGAGTTCATGCAGTTCAAGGTGCGCATGGAGGGCTCCGTGAACGGCCACTACTTCGA
GATCGAGGGCGAGGGCGAGGGCAAGCCCTACGAGGGCACCCAGACCGCCAAGCTGCAGGTGACCAAGGGCGGCCCCCTGC
CCTTCGCCTGGGACATCCTGTCCCCCCAGTTCCAGTACGGCTCCAAGGCCTACGTGAAGCACCCCGCCGACATCCCCGAC
TACATGAAGCTGTCCTTCCCCGAGGGCTTCACCTGGGAGCGCTCCATGAACTTCGAGGACGGCGGCGTGGTGGAGGTGCA
GCAGGACTCCTCCCTGCAGGACGGCACCTTCATCTACAAGGTGAAGTTCAAGGGCGTGAACTTCCCCGCCGACGGCCCCG
TAATGCAGAAGAAGACTGCCGGCTGGGAGCCCTCCACCGAGAAGCTGTACCCCCAGGACGGCGTGCTGAAGGGCGAGATC
TCCCACGCCCTGAAGCTGAAGGACGGCGGCCACTACACCTGCGACTTCAAGACCGTGTACAAGGCCAAGAAGCCCGTGCA
GCTGCCCGGCAACCACTACGTGGACTCCAAGCTGGACATCACCAACCACAACGAGGACTACACCGTGGTGGAGCAGTACG
AGCACGCCGAGGCCCGCCACTCCGGCTCCCAG
dTomato Gene
gtgagcaagggcgaggaggtcatcaaagagttcatgcgcttcaaggtgcgcatggagggctccatgaacggccacgagtt
cgagatcgagggcgagggcgagggccgcccctacgagggcacccagaccgccaagctgaaggtgaccaagggcggccccc
tgcccttcgcctgggacatcctgtccccccagttcatgtacggctccaaggcgtacgtgaagcaccccgccgacatcccc
gattacaagaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggtctggtgaccgt
gacccaggactcctccctgcaggacggcacgctgatctacaaggtgaagatgcgcggcaccaacttcccccccgacggcc
ccgtaatgcagaagaagaccatgggctgggaggcctccaccgagcgcctgtacccccgcgacggcgtgctgaagggcgag
atccaccaggccctgaagctgaaggacggcggccactacctggtggagttcaagaccatctacatggccaagaagcccgt
gcaactgcccggctactactacgtggacaccaagctggacatcacctcccacaacgaggactacaccatcgtggaacagt
acgagcgctccgagggccgccaccacctgttcctgtacggcatggacgagctgtacaag
E2_Crimson Gene
gatagcactgagaacgtcatcaagcccttcatgcgcttcaaggtgcacatggagggctccgtgaacggccacgagttcga
gatcgagggcgtgggcgagggcaagccctacgagggcacccagaccgccaagctgcaagtgaccaagggcggccccctgc
ccttcgcctgggacatcctgtccccccagttcttctacggctccaaggcgtacatcaagcaccccgccgacatccccgac
tacctcaagcagtccttccccgagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgac
ccaggactcctccctgcaggacggcaccctcatctaccacgtgaagttcatcggcgtgaacttcccctccgacggccccg
taatgcagaagaagactctgggctgggagccctccactgagcgcaactacccccgcgacggcgtgctgaagggcgagaac
cacatggcgctgaagctgaagggcggcggccactacctgtgtgagttcaagtccatctacatggccaagaagcccgtgaa
gctgcccggctaccactacgtggactacaagctcgacatcacctcccacaacgaggactacaccgtggtggagcagtacg
agcgcgccgaggcccgccaccacctgttccag
ECFP Gene
GTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTT
CAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGC
CCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTGGGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAG
CACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAA
GACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACG
GCAACATCCTGGGGCACAAGCTGGAGTACAACTACATCAGCCACAACGTCTATATCACCGCCGACAAGCAGAAGAACGGC
ATCAAGGCCAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCC
CATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGA
AGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAG
EGFP Gene
GTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTT
CAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGC
CCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAG
CACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAA
GACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACG
GCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGC
ATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCC
CATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGA
AGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAG
Env_FIV Gene
atggcagaaggatttgcagccaatagacaatggataggactagaagaagctgaagagttattagattttgatatagcaac
acaaatgagtgaagaaggaccactaaatccaggagtaaacccatttagggtacctggaataacagaaaaagaaaagcaaa
actactgtaacatattacaacctaagttacaagatctaaggaacgaaattcaagaggtaaaactggaagaaggaaatgca
ggtaagtttagaagagcaagatttttaaggtattctgatgaaagtgtattgtccctggttcatgcgttcataggatattg
tatatatttaggtaatcgaaataagttaggatctttaagacatgacattgatatagaagcaccccaagaagagtgttata
ataatagagagaagggtacaactgacaatataaaatatggtagacgatgttgcctaggaacggtgactttgtacctgatt
ttatttataggaataataatatattcacagacaaccaacgctcaggtagtatggagacttccaccattagtagtcccagt
agaagaatcagaaataattttttgggattgttgggcaccagaagaacccgcctgtcaggactttcttggggcaatgatac
atctaaaagctaagacaaatataagtatacgagagggacctaccttggggaattgggctagagaaatatgggcaacatta
ttcaaaaaggctactagacaatgtagaagaggcagaatatggaaaagatggaatgagactataacaggaccatcaggatg
tgctaataacacatgttataatgtttcagtaatagtacctgattatcagtgttatttagatagagtagatacttggttac
aagggaaaataaatatatcattatgtctaacaggaggaaaaatgttgtacaataaagttacaaaacaattaagctattgt
acagacccattacaaatcccactgatcaattatacatttggacctaatcaaacatgtatgtggaatacttcacaaattca
ggaccctgaaataccaaaatgtggatggtggaatcaaatggcctattataacagttgtaaatgggaagaggcaaaagtaa
agtttcattgtcaaagaacacagagtcagcctggatcatggtttagagcaatctcgtcatggaaacaaagaaatagatgg
gagtggagaccagattttgaaagtaaaaaggtgaaaatatctctacagtgcaatagcacaaaaaacctaacctttgcaat
gagaagttcaggagattatggagaagtaacgggagcttggatagagtttggatgtcatagaaataaatcaaaacttcatg
ctgaagcaaggtttagaattagatgtagatggaatgtagggagtaatacctcgctcattgatacatgtggaaacactcaa
aaagtttcaggtgcgaatcctgtagattgtaccatgtattcaaataaaatgtacaattgttctttacaaaacgggtttac
tatgaaggtagatgaccttattatgcatttcaatatgaaaaaggctgtagaaatgtataatattgctggaaattggtctt
gtacatctgacttgccatcgtcatgggggtatatgaattgtaattgtacaaatagtagtagtagttatagtggtactaaa
atggcatgtcctagcaatcgaggcatcttaaggaattggtataacccagtggcaggattacgacaatccttagaacagta
tcaagttgtaaaacaaccagattacttagtggtcccagaggaagtcatggaatataaacctagaaggaaaagggcagcta
ttcatgttatgttggctcttgcagcagtattatctattgccggtgcagggacgggggctactgctatagggatggtaaca
caataccaccaagttctggcaacccatcaagaagctgtagaaaaggtgactgaagccttaaagataaacaacttaagatt
agttacattagagcatcaagtactagtaataggattaaaagtagaagctatggaaaaatttttgtatacagctttcgcta
tgcaagaattaggatgtaatcaaaatcaatttttctgcaaaatccctcctgagttgtggacaaggtataatatgactata
aatcaaacaatatggaatcatggaaatataactttgggggaatggtataaccaaacaaaagatttacaacaaaagtttta
tgaaataataatggacatagaacaaaataatgtacaagggaagaaagggatacaacaattacaaaagtgggaagattggg
taggatggataggaaatattccacaatatttaaagggactattgggaggtatcttgggaataggattaggagtgttatta
ttgattttatgtttacctacattggttgattgtataagaaattgtatccacaagatactaggatacacagtaattgcaat
gcctgaagtagaaggagaagaaatacaaccacaaatggaattgaggagaaatggtaggcaatgtggcatgtctgaaaaag
aggaggaatga
eryth Gene
ATGAACGAGAAAAATATAAAACACAGTCAAAACTTTATTACTTCAAAACATAATATAGATAAAATAATGACAAATATAAG
ATTAAATGAACATGATAATATCTTTGAAATCGGCTCAGGAAAAGGCCATTTTACCCTTGAATTAGTAAAGAGGTGTAATT
TCGTAACTGCCATTGAAATAGACCATAAATTATGCAAAACTACAGAAAATAAACTTGTTGATCACGATAATTTCCAAGTT
TTAAACAAGGATATATTGCAGTTTAAATTTCCTAAAAACCAATCCTATAAAATATATGGTAATATACCTTATAACATAAG
TACGGATATAATACGCAAAATTGTTTTTGATAGTATAGCTAATGAGATTTATTTAATCGTGGAATACGGGTTTGCTAAAA
GATTATTAAATACAAAACGCTCATTGGCATTACTTTTAATGGCAGAAGTTGATATTTCTATATTAAGTATGGTTCCAAGA
GAATATTTTCATCCTAAACCTAAAGTGAATAGCTCACTTATCAGATTAAGTAGAAAAAAATCAAGAATATCACACAAAGA
TAAACAAAAGTATAATTATTTCGTTATGAAATGGGTTAACAAAGAATACAAGAAAATATTTACAAAAAATCAATTTAACA
ATTCCTTAAAACATGCAGGAATTGACGATTTAAACAATATTAGCTTTGAACAATTCTTATCTCTTTTCAATAGCTATAAA
TTATTTAATAAGTAA
EYFP Gene
GTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTT
CAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGC
CCGTGCCCTGGCCCACCCTCGTGACCACCTTCGGCTACGGCCTGCAGTGCTTCGCCCGCTACCCCGACCACATGAAGCAG
CACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAA
GACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACG
GCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGC
ATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCC
CATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCTACCAGTCCGCCCTGAGCAAAGACCCCAACGAGA
AGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTCCGGA
CTCAGATCTCGAGCT
firefly_Luciferase Gene
ATGGAAGACGCCAAAAACATAAAGAAAGGCCCGGCGCCATTCTATCCGCTGGAAGATGGAACCGCTGGAGAGCAACTGCA
TAAGGCTATGAAGAGATACGCCCTGGTTCCTGGAACAATTGCTTTTACAGATGCACATATCGAGGTGGACATCACTTACG
CTGAGTACTTCGAAATGTCCGTTCGGTTGGCAGAAGCTATGAAACGATATGGGCTGAATACAAATCACAGAATCGTCGTA
TGCAGTGAAAACTCTCTTCAATTCTTTATGCCGGTGTTGGGCGCGTTATTTATCGGAGTTGCAGTTGCGCCCGCGAACGA
CATTTATAATGAACGTGAATTGCTCAACAGTATGGGCATTTCGCAGCCTACCGTGGTGTTCGTTTCCAAAAAGGGGTTGC
AAAAAATTTTGAACGTGCAAAAAAAGCTCCCAATCATCCAAAAAATTATTATCATGGATTCTAAAACGGATTACCAGGGA
TTTCAGTCGATGTACACGTTCGTCACATCTCATCTACCTCCCGGTTTTAATGAATACGATTTTGTGCCAGAGTCCTTCGA
TAGGGACAAGACAATTGCACTGATCATGAACTCCTCTGGATCTACTGGTCTGCCTAAAGGTGTCGCTCTGCCTCATAGAA
CTGCCTGCGTGAGATTCTCGCATGCCAGAGATCCTATTTTTGGCAATCAAATCATTCCGGATACTGCGATTTTAAGTGTT
GTTCCATTCCATCACGGTTTTGGAATGTTTACTACACTCGGATATTTGATATGTGGATTTCGAGTCGTCTTAATGTATAG
ATTTGAAGAAGAGCTGTTTCTGAGGAGCCTTCAGGATTACAAGATTCAAAGTGCGCTGCTGGTGCCAACCCTATTCTCCT
TCTTCGCCAAAAGCACTCTGATTGACAAATACGATTTATCTAATTTACACGAAATTGCTTCTGGTGGCGCTCCCCTCTCT
AAGGAAGTCGGGGAAGCGGTTGCCAAGAGGTTCCATCTGCCAGGTATCAGGCAAGGATATGGGCTCACTGAGACTACATC
AGCTATTCTGATTACACCCGAGGGGGATGATAAACCGGGCGCGGTCGGTAAAGTTGTTCCATTTTTTGAAGCGAAGGTTG
TGGATCTGGATACCGGGAAAACGCTGGGCGTTAATCAAAGAGGCGAACTGTGTGTGAGAGGTCCTATGATTATGTCCGGT
TATGTAAACAATCCGGAAGCGACCAACGCCTTGATTGACAAGGATGGATGGCTACATTCTGGAGACATAGCTTACTGGGA
CGAAGACGAACACTTCTTCATCGTTGACCGCCTGAAGTCTCTGATTAAGTACAAAGGCTATCAGGTGGCTCCCGCTGAAT
TGGAATCCATCTTGCTCCAACACCCCAACATCTTCGACGCAGGTGTCGCAGGTCTTCCCGACGATGACGCCGGTGAACTT
CCCGCCGCCGTTGTTGTTTTGGAGCACGGAAAGACGATGACGGAAAAAGAGATCGTGGATTACGTCGCCAGTCAAGTAAC
AACCGCGAAAAAGTTGCGCGGAGGAGTTGTGTTTGTGGACGAAGTACCGAAAGGTCTTACCGGAAAACTCGACGCAAGAA
AAATCAGAGAGATCCTCATAAAGGCCAAGAAGGGCGGAAAGATCGCCGTGTAA
FLP_recombinase Gene
ATGCCACAATTTGATATATTATGTAAAACACCACCTAAGGTGCTTGTTCGTCAGTTTGTGGAAAGGTTTGAAAGACCTTC
AGGTGAGAAAATAGCATTATGTGCTGCTGAACTAACCTATTTATGTTGGATGATTACACATAACGGAACAGCAATCAAGA
GAGCCACATTCATGAGCTATAATACTATCATAAGCAATTCGCTGAGTTTCGATATTGTCAATAAATCACTCCAGTTTAAA
TACAAGACGCAAAAAGCAACAATTCTGGAAGCCTCATTAAAGAAATTGATTCCTGCTTGGGAATTTACAATTATTCCTTA
CTATGGACAAAAACATCAATCTGATATCACTGATATTGTAAGTAGTTTGCAATTACAGTTCGAATCATCGGAAGAAGCAG
ATAAGGGAAATAGCCACAGTAAAAAAATGCTTAAAGCACTTCTAAGTGAGGGTGAAAGCATCTGGGAGATCACTGAGAAA
ATACTAAATTCGTTTGAGTATACTTCGAGATTTACAAAAACAAAAACTTTATACCAATTCCTCTTCCTAGCTACTTTCAT
CAATTGTGGAAGATTCAGCGATATTAAGAACGTTGATCCGAAATCATTTAAATTAGTCCAAAATAAGTATCTGGGAGTAA
TAATCCAGTGTTTAGTGACAGAGACAAAGACAAGCGTTAGTAGGCACATATACTTCTTTAGCGCAAGGGGTAGGATCGAT
CCACTTGTATATTTGGATGAATTTTTGAGGAATTCTGAACCAGTCCTAAAACGAGTAAATAGGACCGGCAATTCTTCAAG
CAATAAACAGGAATACCAATTATTAAAAGATAACTTAGTCAGATCGTACAATAAAGCTTTGAAGAAAAATGCGCCTTATT
CAATCTTTGCTATAAAAAATGGCCCAAAATCTCACATTGGAAGACATTTGATGACCTCATTTCTTTCAATGAAGGGCCTA
ACGGAGTTGACTAATGTTGTGGGAAATTGGAGCGATAAGCGTGCTTCTGCCGTGGCCAGGACAACGTATACTCATCAGAT
AACAGCAATACCTGATCACTACTTCGCACTAGTTTCTCGGTACTATGCATATGATCCAATATCAAAGGAAATGATAGCAT
TGAAGGATGAGACTAATCCAATTGAGGAGTGGCAGCATATAGAACAGCTAAAGGGTAGTGCTGAAGGAAGCATACGATAC
CCCGCATGGAATGGGATAATATCACAGGAGGTACTAGACTACCTTTCATCCTACATAAATAGACGCATATAA
Gag_HIV Gene
atgggtgcgagagcgtcagtattaagcgggggagaattagatcgatgggaaaaaattcggttaaggccagggggaaagaa
aaaatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagaaacat
cagaaggctgtagacaaatactgggacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataat
acagtagcaaccctctattgtgtgcatcaaaggatagagataaaagacaccaaggaagctttagacaagatagaggaaga
gcaaaacaaaagtaagaaaaaagcacagcaagcagcagctgacacaggacacagcaatcaggtcagccaaaattacccta
tagtgcagaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaatgcatgggtaaaagtagtagaa
gagaaggctttcagcccagaagtgatacccatgttttcagcattatcagaaggagccaccccacaagatttaaacaccat
gctaaacacagtggggggacatcaagcagccatgcaaatgttaaaagagaccatcaatgaggaagctgcagaatgggata
gagtgcatccagtgcatgcagggcctattgcaccaggccagatgagagaaccaaggggaagtgacatagcaggaactact
agtacccttcaggaacaaataggatggatgacaaataatccacctatcccagtaggagaaatttataaaagatggataat
cctgggattaaataaaatagtaagaatgtatagccctaccagcattctggacataagacaaggaccaaaggaacccttta
gagactatgtagaccggttctataaaactctaagagccgagcaagcttcacaggaggtaaaaaattggatgacagaaacc
ttgttggtccaaaatgcgaacccagattgtaagactattttaaaagcattgggaccagcggctacactagaagaaatgat
gacagcatgtcagggagtaggaggacccggccataaggcaagagttttggctgaagcaatgagccaagtaacaaattcag
ctaccataatgatgcagagaggcaattttaggaaccaaagaaagattgttaagtgtttcaattgtggcaaagaagggcac
acagccagaaattgcagggcccctaggaaaaagggctgttggaaatgtggaaaggaaggacaccaaatgaaagattgtac
tgagagacaggctaattttttagggaagatctggccttcctacaagggaaggccagggaattttcttcagagcagaccag
agccaacagccccaccagaagagagcttcaggtctggggtagagacaacaactccccctcagaagcaggagccgatagac
aaggaactgtatcctttaacttccctcaggtcactctttggcaacgacccctcgtcacaataa
gent Gene
ATGTTACGCAGCAGCAACGATGTTACGCAGCAGGGCAGTCGCCCTAAAACAAAGTTAGGTGGCTCAAGTATGGGCATCAT
TCGCACATGTAGGCTCGGCCCTGACCAAGTCAAATCCATGCGGGCTGCTCTTGATCTTTTCGGTCGTGAGTTCGGAGACG
TAGCCACCTACTCCCAACATCAGCCGGACTCCGATTACCTCGGGAACTTGCTCCGTAGTAAGACATTCATCGCGCTTGCT
GCCTTCGACCAAGAAGCGGTTGTTGGCGCTCTCGCGGCTTACGTTCTGCCCAGGTTTGAGCAGCCGCGTAGTGAGATCTA
TATCTATGATCTCGCAGTCTCCGGCGAGCACCGGAGGCAGGGCATTGCCACCGCGCTCATCAATCTCCTCAAGCATGAGG
CCAACGCGCTTGGTGCTTATGTGATCTACGTGCAAGCAGATTACGGTGACGATCCCGCAGTGGCTCTCTATACAAAGTTG
GGCATACGGGAAGAAGTGATGCACTTTGATATCGACCCAAGTACCGCCACCTAA
GFP Gene
AAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTCTCTGT
CAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACTACTGGAAAGCTACCTGTTC
CATGGCCAACACTTGTCACTACTTTCTCTTATGGTGTTCAATGCTTTTCAAGATACCCAGATCATATGAAACAGCATGAC
TTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTACAAAGATGACGGGAACTACAAATCACG
TGCTGAAGTCAAGTTTGAAGGTGATACCCTCGTTAATAGAATTGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACA
TTCTTGGACACAAAATGGAATACAACTATAACTCACACAATGTATACATCATGGCAGACAAACAAAAGAATGGAATCAAA
GTTAACTTCAAAATTAGACACAACATTGAAGATGGAAGCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGG
CGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCCACACAATCTGCCCTTTCCAAAGATCCCAACGAAAAGAGAG
ATCACATGATCCTTCTTGAGTTTGTAACAGCTGCTGGGATTACACATGGCATGGATGAACTATACAAA
GST Gene
ATGTCCCCTATACTAGGTTATTGGAAAATTAAGGGCCTTGTGCAACCCACTCGACTTCTTTTGGAATATCTTGAAGAAAA
ATATGAAGAGCATTTGTATGAGCGCGATGAAGGTGATAAATGGCGAAACAAAAAGTTTGAATTGGGTTTGGAGTTTCCCA
ATCTTCCTTATTATATTGATGGTGATGTTAAATTAACACAGTCTATGGCCATCATACGTTATATAGCTGACAAGCACAAC
ATGTTGGGTGGTTGTCCAAAAGAGCGTGCAGAGATTTCAATGCTTGAAGGAGCGGTTTTGGATATTAGATACGGTGTTTC
GAGAATTGCATATAGTAAAGACTTTGAAACTCTCAAAGTTGATTTTCTTAGCAAGCTACCTGAAATGCTGAAAATGTTCG
AAGATCGTTTATGTCATAAAACATATTTAAATGGTGATCATGTAACCCATCCTGACTTCATGTTGTATGACGCTCTTGAT
GTTGTTTTATACATGGACCCAATGTGCCTGGATGCGTTCCCAAAATTAGTTTGTTTTAAAAAACGTATTGAAGCTATCCC
ACAAATTGATAAGTACTTGAAATCCAGCAAGTATATAGCATGGCCTTTGCAGGGCTGGCAAGCCACGTTTGGTGGTGGCG
ACCATCCTCCAAAATCGGATCTGGAAGTTCTGTTCCAGGGGCCCCTGGGATCCCCGGAATTCCCGGGTCGACTCGAGCGG
CCGCATCGTGACTGA
HcRed1 Gene
GTGAGCGGCCTGCTGAAGGAGAGTATGCGCATCAAGATGTACATGGAGGGCACCGTGAACGGCCACTACTTCAAGTGCGA
GGGCGAGGGCGACGGCAACCCCTTCGCCGGCACCCAGAGCATGAGAATCCACGTGACCGAGGGCGCCCCCCTGCCCTTCG
CCTTCGACATCCTGGCCCCCTGCTGCGAGTACGGCAGCAGGACCTTCGTGCACCACACCGCCGAGATCCCCGACTTCTTC
AAGCAGAGCTTCCCCGAGGGCTTCACCTGGGAGAGAACCACCACCTACGAGGACGGCGGCATCCTGACCGCCCACCAGGA
CACCAGCCTGGAGGGCAACTGCCTGATCTACAAGGTGAAGGTGCACGGCACCAACTTCCCCGCCGACGGCCCCGTGATGA
AGAACAAGAGCGGCGGCTGGGAGCCCAGCACCGAGGTGGTGTACCCCGAGAACGGCGTGCTGTGCGGCCGGAACGTGATG
GCCCTGAAGGTGGGCGACCGGCACCTGATCTGCCACCACTACACCAGCTACCGGAGCAAGAAGGCCGTGCGCGCCCTGAC
CATGCCCGGCTTCCACTTCACCGACATCCGGCTCCAGATGCTGCGGAAGAAGAAGGACGAGTACTTCGAGCTGTACGAGG
CCAGCGTGGCCCGGTACAGCGACCTGCCCGAGAAGGCCAAC
HIS3 Gene
ATGACAGAGCAGAAAGCCCTAGTAAAGCGTATTACAAATGAAACCAAGATTCAGATTGCGATCTCTTTAAAGGGTGGTCC
CCTAGCGATAGAGCACTCGATCTTCCCAGAAAAAGAGGCAGAAGCAGTAGCAGAACAGGCCACACAATCGCAAGTGATTA
ACGTCCACACAGGTATAGGGTTTCTGGACCATATGATACATGCTCTGGCCAAGCATTCCGGCTGGTCGCTAATCGTTGAG
TGCATTGGTGACTTACACATAGACGACCATCACACCACTGAAGACTGCGGGATTGCTCTCGGTCAAGCTTTTAAAGAGGC
CCTACTGGCGCGTGGAGTAAAAAGGTTTGGATCAGGATTTGCGCCTTTGGATGAGGCACTTTCCAGAGCGGTGGTAGATC
TTTCGAACAGGCCGTACGCAGTTGTCGAACTTGGTTTGCAAAGGGAGAAAGTAGGAGATCTCTCTTGCGAGATGATCCCG
CATTTTCTTGAAAGCTTTGCAGAGGCTAGCAGAATTACCCTCCACGTTGATTGTCTGCGAGGCAAGAATGATCATCACCG
TAGTGAGAGTGCGTTCAAGGCTCTTGCGGTTGCCATAAGAGAAGCCACCTCGCCCAATGGTACCAACGATGTTCCCTCCA
CCAAAGGTGTTCTTATG
HIS4 Gene
ATGACATTTCCCTTGCTACCTGCATACGCAAGTGTTGCAGAGTTTGATAATTCCTTGAGTTTGGTAGGAAAAGCCGTGTT
TCCCTATGCTGCTGACCAGCTGCACAACCTGATCAAGTTCACTCAATCGACTGAGCTTCAAGTTAATGTGCAAGTTGAGT
CATCCGTTACAGAGGACCAATTTGAGGAGCTGATCGACAACTTGCTCAAGTTGTACAATAATGGTATCAATGAAGTGATT
TTGGACCTAGATTTGGCAGAAAGAGTTGTCCAAAGGATCCCAGGCGCTAGGGTTATCTATAGGACCCTGGTTGATAAAGT
TGCATCCTTGCCCGCTAATGCTAGTATCGCTGTGCCTTTTTCTTCTCCACTGGGCGATTTGAAAAGTTTCACTAATGGCG
GTAGTAGAACTGTTTATGCTTTTTCTGAGACCGCAAAGTTGGTAGATGTGACTTCCACTGTTGCTTCTGGTATAATCCCC
ATTATTGATGCTCGGCAATTGACTACTGAATACGAACTTTCTGAAGATGTCAAAAAGTTCCCTGTCAGTGAAATTTTGTT
GGCGTCTTTGACTACTGACCGCCCCGATGGTCTATTCACTACTTTGGTGGCTGACTCTTCTAATTACTCGTTGGGCCTGG
TGTACTCGTCCAAAAAGTCTATTCCGGAGGCTATAAGGACACAAACTGGAGTCTACCAATCTCGTCGTCACGGTTTGTGG
TATAAAGGTGCTACATCTGGAGCAACTCAAAAGTTGCTGGGTATCGAATTGGATTGTGATGGAGACTGCTTGAAATTTGT
GGTTGAACAAACAGGTGTTGGTTTCTGTCACTTGGAACGCACTTCCTGTTTTGGCCAATCAAAGGGTCTTAGAGCCATGG
AAGCCACCTTGTGGGATCGTAAGAGCAATGCTCCAGAAGGTTCTTATACCAAACGGTTATTTGACGACGAAGTTTTGTTG
AACGCTAAAATTAGGGAGGAAGCTGATGAACTTGCAGAAGCTAAATCCAAGGAAGATATAGCCTGGGAATGTGCTGACTT
ATTTTATTTTGCATTAGTTAGATGTGCCAAGTACGGCGTGACGTTGGACGAGGTGGAGAGAAACCTGGATATGAAGTCCC
TAAAGGTCACTAGAAGGAAAGGAGATGCCAAGCCAGGATACACCAAGGAACAACCTAAAGAAGAATCCAAACCTAAAGAA
GTCCCTTCTGAAGGTCGTATTGAATTGTGCAAAATTGACGTTTCTAAGGCCTCCTCACAAGAAATTGAAGATGCCCTTCG
TCGTCCTATCCAGAAAACGGAACAGATTATGGAATTAGTCAAACCAATTGTCGACAATGTTCGTCAAAATGGTGACAAAG
CCCTTTTAGAACTAACTGCCAAGTTTGATGGAGTCGCTTTGAAGACACCTGTGTTAGAAGCTCCTTTCCCAGAGGAACTT
ATGCAATTGCCAGATAACGTTAAGAGAGCCATTGATCTCTCTATAGATAACGTCAGGAAATTCCATGAAGCTCAACTAGC
GGAGACGTTGCAAGTTGAGACTTGCCCTGGTGTAGTCTGCTCTCGTTTTGCAAGACCTATTGAGAAAGTTGGCCTCTATA
TTCCTGGTGGAACCGCAATTCTGCCTTCCACTTCCCTGATGCTGGGTGTTCCTGCCAAAGTTGCTGGTTGCAAAGAAATT
GTTTTTGCATCTCCACCTAAGAAGGATGGTACCCTTACCCCAGAAGTCATCTACGTTGCCCACAAGGTTGGTGCTAAGTG
TATCGTGCTAGCAGGAGGCGCCCAGGCAGTAGCTGCTATGGCTTACGGAACAGAAACTGTTCCTAAGTGTGACAAAATAT
TTGGTCCAGGAAACCAGTTCGTTACTGCTGCCAAGATGATGGTTCAAAATGACACATCAGCCCTGTGTAGTATTGACATG
CCTGCTGGGCCTTCTGAAGTTCTAGTTATTGCTGATAAATACGCTGATCCAGATTTCGTTGTCTCAGACCTTCTGTCTCA
AGCTGAACATGGTATTGATTCCCAGGTGATTCTGTTGGCTGTCGATATGACAGACAAGGAGCTTGCCAGAATTGAAGATG
CTGTTCACAACCAAGCTGTGCAGTTGCCAAGGGTTGAAATTGTACGCAAGTGTATTGCACACTCTACAACCCTATCGGTT
GCAACCTACGAGCAGGCTTTGGAAATGTCCAATCAGTACGCTCCTGAACACTTGATCCTGCAAATCGAGAATGCTTCTTA
TGTTGATCAAGTACAACACGCTGGATCTGTGTTTGTTGGTGCCTACTCTCCAGAGAGTTGTGGAGATTACTCCTCCGGTA
CCAACCACACTTTGCCAACGTACGGATATGCCCGTCAATACAGCGGAGTTAACACTGCAACCTTCCAGAAGTTCATCACT
TCACAAGACGTAACTCCTGAGGGACTGAAACATATTGGCCAAGCAGTGATGGATCTGGCTGCTGTTGAAGGTCTAGATGC
TCACCGCAATGCTGTTAAGGTTCGTATGGAGAAACTGGGACTTATTTAA
hygroB Gene
ATGGATAGATCCGGAAAGCCTGAACTCACCGCGACGTCTGTCGAGAAGTTTCTGATCGAAAAGTTCGACAGCGTCTCCGA
CCTGATGCAGCTCTCGGAGGGCGAAGAATCTCGTGCTTTCAGCTTCGATGTAGGAGGGCGTGGATATGTCCTGCGGGTAA
ATAGCTGCGCCGATGGTTTCTACAAAGATCGTTATGTTTATCGGCACTTTGCATCGGCCGCGCTCCCGATTCCGGAAGTG
CTTGACATTGGGGAATTCAGCGAGAGCCTGACCTATTGCATCTCCCGCCGTGCACAGGGTGTCACGTTGCAAGACCTGCC
TGAAACCGAACTGCCCGCTGTTCTGCAGCCGGTCGCGGAGGCCATGGATGCGATCGCTGCGGCCGATCTTAGCCAGACGA
GCGGGTTCGGCCCATTCGGACCGCAAGGAATCGGTCAATACACTACATGGCGTGATTTCATATGCGCGATTGCTGATCCC
CATGTGTATCACTGGCAAACTGTGATGGACGACACCGTCAGTGCGTCCGTCGCGCAGGCTCTCGATGAGCTGATGCTTTG
GGCCGAGGACTGCCCCGAAGTCCGGCACCTCGTGCACGCGGATTTCGGCTCCAACAATGTCCTGACGGACAATGGCCGCA
TAACAGCGGTCATTGACTGGAGCGAGGCGATGTTCGGGGATTCCCAATACGAGGTCGCCAACATCTTCTTCTGGAGGCCG
TGGTTGGCTTGTATGGAGCAGCAGACGCGCTACTTCGAGCGGAGGCATCCGGAGCTTGCAGGATCGCCGCGGCTCCGGGC
GTATATGCTCCGCATTGGTCTTGACCAACTCTATCAGAGCTTGGTTGACGGCAATTTCGATGATGCAGCTTGGGCGCAGG
GTCGATGCGACGCAATCGTCCGATCCGGAGCCGGGACTGTCGGGCGTACACAAATCGCCCGCAGAAGCGCGGCCGTCTGG
ACCGATGGCTGTGTAGAAGTACTCGCCGATAGTGGAAACCGACGCCCCAGCACTCGTCCGAGGGCAAAGGAA
KanR1 Gene
ATGGCTAAAATGAGAATATCACCGGAATTGAAAAAACTGATCGAAAAATACCGCTGCGTAAAAGATACGGAAGGAATGTC
TCCTGCTAAGGTATATAAGCTGGTGGGAGAAAATGAAAACCTATATTTAAAAATGACGGACAGCCGGTATAAAGGGACCA
CCTATGATGTGGAACGGGAAAAGGACATGATGCTATGGCTGGAAGGAAAGCTGCCTGTTCCAAAGGTCCTGCACTTTGAA
CGGCATGATGGCTGGAGCAATCTGCTCATGAGTGAGGCCGATGGCGTCCTTTGCTCGGAAGAGTATGAAGATGAACAAAG
CCCTGAAAAGATTATCGAGCTGTATGCGGAGTGCATCAGGCTCTTTCACTCCATCGACATATCGGATTGTCCCTATACGA
ATAGCTTAGACAGCCGCTTAGCCGAATTGGATTACTTACTGAATAACGATCTGGCCGATGTGGATTGCGAAAACTGGGAA
GAAGACACTCCATTTAAAGATCCGCGCGAGCTGTATGATTTTTTAAAGACGGAAAAGCCCGAAGAGGAACTTGTCTTTTC
CCACGGCGACCTGGGAGACAGCAACATCTTTGTGAAAGATGGCAAAGTAAGTGGCTTTATTGATCTTGGGAGAAGCGGCA
GGGCGGACAAGTGGTATGACATTGCCTTCTGCGTCCGGTCGATCAGGGAGGATATCGGGGAAGAACAGTATGTCGAGCTA
TTTTTTGACTTACTGGGGATCAAGCCTGATTGGGAGAAAATAAAATATTATATTTTACTGGATGAATTGTTTTAG
KanR2 Gene
ATGAGCCATATTCAACGGGAAACGTCTTGCTCGAGGCCGCGATTAAATTCCAACATGGATGCTGATTTATATGGGTATAA
ATGGGCTCGCGATAATGTCGGGCAATCAGGTGCGACAATCTATCGATTGTATGGGAAGCCCGATGCGCCAGAGTTGTTTC
TGAAACATGGCAAAGGTAGCGTTGCCAATGATGTTACAGATGAGATGGTCAGACTAAACTGGCTGACGGAATTTATGCCT
CTTCCGACCATCAAGCATTTTATCCGTACTCCTGATGATGCATGGTTACTCACCACTGCGATCCCCGGGAAAACAGCATT
CCAGGTATTAGAAGAATATCCTGATTCAGGTGAAAATATTGTTGATGCGCTGGCAGTGTTCCTGCGCCGGTTGCATTCGA
TTCCTGTTTGTAATTGTCCTTTTAACAGCGATCGCGTATTTCGTCTCGCTCAGGCGCAATCACGAATGAATAACGGTTTG
GTTGATGCGAGTGATTTTGATGACGAGCGTAATGGCTGGCCTGTTGAACAAGTCTGGAAAGAAATGCATAAGCTTTTGCC
ATTCTCACCGGATTCAGTCGTCACTCATGGTGATTTCTCACTTGATAACCTTATTTTTGACGAGGGGAAATTAATAGGTT
GTATTGATGTTGGACGAGTCGGAATCGCAGACCGATACCAGGATCTTGCCATCCTATGGAACTGCCTCGGTGAGTTTTCT
CCTTCATTACAGAAACGGCTTTTTCAAAAATATGGTATTGATAATCCTGATATGAATAAATTGCAGTTTCATTTGATGCT
CGATGAGTTTTTCTAA
lacZ Gene
ATGTCGTTTACTTTGACCAACAAGAACGTGATTTTCGTTGCCGGTCTGGGAGGCATTGGTCTGGACACCAGCAAGGAGCT
GCTCAAGCGCGATCCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCAC
ATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGC
GAATGGCGCTTTGCCTGGTTTCCGGCACCAGAAGCGGTGCCGGAAAGCTGGCTGGAGTGCGATCTTCCTGAGGCCGATAC
TGTCGTCGTCCCCTCAAACTGGCAGATGCACGGTTACGATGCGCCCATCTACACCAACGTAACCTATCCCATTACGGTCA
ATCCGCCGTTTGTTCCCACGGAGAATCCGACGGGTTGTTACTCGCTCACATTTAATGTTGATGAAAGCTGGCTACAGGAA
GGCCAGACGCGAATTATTTTTGATGGCGTTAACTCGGCGTTTCATCTGTGGTGCAACGGGCGCTGGGTCGGTTACGGCCA
GGACAGTCGTTTGCCGTCTGAATTTGACCTGAGCGCATTTTTACGCGCCGGAGAAAACCGCCTCGCGGTGATGGTGCTGC
GTTGGAGTGACGGCAGTTATCTGGAAGATCAGGATATGTGGCGGATGAGCGGCATTTTCCGTGACGTCTCGTTGCTGCAT
AAACCGACTACACAAATCAGCGATTTCCATGTTGCCACTCGCTTTAATGATGATTTCAGCCGCGCTGTACTGGAGGCTGA
AGTTCAGATGTGCGGCGAGTTGCGTGACTACCTACGGGTAACAGTTTCTTTATGGCAGGGTGAAACGCAGGTCGCCAGCG
GCACCGCGCCTTTCGGCGGTGAAATTATCGATGAGCGTGGTGGTTATGCCGATCGCGTCACACTACGTCTGAACGTCGAA
AACCCGAAACTGTGGAGCGCCGAAATCCCGAATCTCTATCGTGCGGTGGTTGAACTGCACACCGCCGACGGCACGCTGAT
TGAAGCAGAAGCCTGCGATGTCGGTTTCCGCGAGGTGCGGATTGAAAATGGTCTGCTGCTGCTGAACGGCAAGCCGTTGC
TGATTCGAGGCGTTAACCGTCACGAGCATCATCCTCTGCATGGTCAGGTCATGGATGAGCAGACGATGGTGCAGGATATC
CTGCTGATGAAGCAGAACAACTTTAACGCCGTGCGCTGTTCGCATTATCCGAACCATCCGCTGTGGTACACGCTGTGCGA
CCGCTACGGCCTGTATGTGGTGGATGAAGCCAATATTGAAACCCACGGCATGGTGCCAATGAATCGTCTGACCGATGATC
CGCGCTGGCTACCGGCGATGAGCGAACGCGTAACGCGAATGGTGCAGCGCGATCGTAATCACCCGAGTGTGATCATCTGG
TCGCTGGGGAATGAATCAGGCCACGGCGCTAATCACGACGCGCTGTATCGCTGGATCAAATCTGTCGATCCTTCCCGCCC
GGTGCAGTATGAAGGCGGCGGAGCCGACACCACGGCCACCGATATTATTTGCCCGATGTACGCGCGCGTGGATGAAGACC
AGCCCTTCCCGGCTGTGCCGAAATGGTCCATCAAAAAATGGCTTTCGCTACCTGGAGAGACGCGCCCGCTGATCCTTTGC
GAATACGCCCACGCGATGGGTAACAGTCTTGGCGGTTTCGCTAAATACTGGCAGGCGTTTCGTCAGTATCCCCGTTTACA
GGGCGGCTTCGTCTGGGACTGGGTGGATCAGTCGCTGATTAAATATGATGAAAACGGCAACCCGTGGTCGGCTTACGGCG
GTGATTTTGGCGATACGCCGAACGATCGCCAGTTCTGTATGAACGGTCTGGTCTTTGCCGACCGCACGCCGCATCCAGCG
CTGACGGAAGCAAAACACCAGCAGCAGTTTTTCCAGTTCCGTTTATCCGGGCAAACCATCGAAGTGACCAGCGAATACCT
GTTCCGTCATAGCGATAACGAGCTCCTGCACTGGATGGTGGCGCTGGATGGTAAGCCGCTGGCAAGCGGTGAAGTGCCTC
TGGATGTCGCTCCACAAGGTAAACAGTTGATTGAACTGCCTGAACTACCGCAGCCGGAGAGCGCCGGGCAACTCTGGCTC
ACAGTACGCGTAGTGCAACCGAACGCGACCGCATGGTCAGAAGCCGGGCACATCAGCGCCTGGCAGCAGTGGCGTCTGGC
GGAAAACCTCAGTGTGACGCTCCCCGCCGCGTCCCACGCCATCCCGCATCTGACCACCAGCGAAATGGATTTTTGCATCG
AGCTGGGTAATAAGCGTTGGCAATTTAACCGCCAGTCAGGCTTTCTTTCACAGATGTGGATTGGCGATAAAAAACAACTG
CTGACGCCGCTGCGCGATCAGTTCACCCGTGCACCGCTGGATAACGACATTGGCGTAAGTGAAGCGACCCGCATTGACCC
TAACGCCTGGGTCGAACGCTGGAAGGCGGCGGGCCATTACCAGGCCGAAGCAGCGTTGTTGCAGTGCACGGCAGATACAC
TTGCTGATGCGGTGCTGATTACGACCGCTCACGCGTGGCAGCATCAGGGGAAAACCTTATTTATCAGCCGGAAAACCTAC
CGGATTGATGGTAGTGGTCAAATGGCGATTACCGTTGATGTTGAAGTGGCGAGCGATACACCGCATCCGGCGCGGATTGG
CCTGAACTGCCAGCTGGCGCAGGTAGCAGAGCGGGTAAACTGGCTCGGATTAGGGCCGCAAGAAAACTATCCCGACCGCC
TTACTGCCGCCTGTTTTGACCGCTGGGATCTGCCATTGTCAGACATGTATACCCCGTACGTCTTCCCGAGCGAAAACGGT
CTGCGCTGCGGGACGCGCGAATTGAATTATGGCCCACACCAGTGGCGCGGCGACTTCCAGTTCAACATCAGCCGCTACAG
TCAACAGCAACTGATGGAAACCAGCCATCGCCATCTGCTGCACGCGGAAGAAGGCACATGGCTGAATATCGACGGTTTCC
ATATGGGGATTGGTGGCGACGACTCCTGGAGCCCGTCAGTATCGGCGGAATTACAGCTGAGCGCCGGTCGCTACCATTAC
CAGTTGGTCTGGTGTCAAAAA
LEU2 Gene
ATGTCTGCCCCTATGTCTGCCCCTAAGAAGATCGTCGTTTTGCCAGGTGACCACGTTGGTCAAGAAATCACAGCCGAAGC
CATTAAGGTTCTTAAAGCTATTTCTGATGTTCGTTCCAATGTCAAGTTCGATTTCGAAAATCATTTAATTGGTGGTGCTG
CTATTGATGCTACAGGTGTCCCACTTCCAGATGAGGCGCTGGAAGCCTCCAAGAAGGCTGATGCCGTTTTGTTAGGTGCT
GTGGGTGGTCCTAAATGGGGTACTGGTAGTGTTAGACCTGAACAAGGTTTACTAAAAATCCGTAAAGAACTTCAATTGTA
CGCCAACTTAAGACCATGTAACTTTGCATCCGACTCTCTTTTAGACTTATCTCCAATCAAGCCACAATTTGCTAAAGGTA
CTGACTTCGTTGTTGTCAGAGAATTAGTGGGAGGTATTTACTTTGGTAAGAGAAAGGAAGACGATGGTGATGGTGTCGCT
TGGGATAGTGAACAATACACCGTTCCAGAAGTGCAAAGAATCACAAGAATGGCCGCTTTCATGGCCCTACAACATGAGCC
ACCATTGCCTATTTGGTCCTTGGATAAAGCTAATGTTTTGGCCTCTTCAAGATTATGGAGAAAAACTGTGGAGGAAACCA
TCAAGAACGAGTTCCCTACATTGAAGGTTCAACATCAATTGATTGATTCTGCCGCCATGATCCTAGTTAAGAACCCAACC
CACCTAAATGGTATTATAATCACCAGCAACATGTTTGGTGATATTATCTCCGATGAAGCCTCCGTTATCCCAGGTTCCTT
GGGTTTGTTGCCATCTGCGTCCTTGGCCTCTTTGCCAGACAAGAACACCGCATTTGGTTTGTACGAACCATGCCACGGTT
CTGCTCCAGATTTGCCAAAGAATAAGGTCAACCCTATCGCCACTATCTTGTCTGCTGCAATGATGTTGAAATTGTCATTG
AACTTGCCTGAAGAAGGTAAGGCCATTGAAGATGCAGTTAAAAAGGTTTTGGATGCAGGTATCAGAACTGGTGATTTAGG
TGGTTCCAACAGTACCACCGAAGTCGGTGATGCTGTCGCCGAAGAAGTTAAGAAAATCCTTGCTTAA
mBanana Gene
GTGAGCAAGGGCGAGGAGAATAACATGGCCGTCATCAAGGAGTTCATGCGCTTCAAGGTGCGCATGGAGGGCTCCGTGAA
CGGCCACGAGTTCGAGATCGAGGGCGAGGGCGAGGGCCGCCCCTACGAGGGCACCCAGACCGCCAAGCTGAAGGTGACCA
AGGGTGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCTCAGTTCTGTTACGGCTCCAAGGCCTACGTGAAGCACCCC
ACTGGTATCCCCGACTACTTCAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTTCGAGGACGGCGG
CGTGGTGACCGTGGCTCAGGACTCCTCCCTGCAGGACGGCGAGTTCATCTACAAGGTGAAGCTGCGCGGCACCAACTTCC
CCTCCGACGGCCCCGTAATGCAGAAGAAGACCATGGGCTGGGAGGCCTCCTCCGAGCGGATGTACCCCGAGGACGGCGCC
CTGAAGGGCGAGATCAAGATGAGGCTGAAGCTGAAGGACGGCGGCCACTACAGCGCCGAGACCAAGACCACCTACAAGGC
CAAGAAGCCCGTGCAGTTGCCCGGCGCCTACATAGCCGGCGAGAAGATCGACATCACCTCCCACAATGAGGACTACACTA
TCGTGGAATTGTACGAGCGCGCCGAGGGCCGCCACTCCACCGGCGGCATGGACGAGCTGTACAAG
mCherry Gene
GTGAGCAAGGGCGAGGAGGATAACATGGCCATCATCAAGGAGTTCATGCGCTTCAAGGTGCACATGGAGGGCTCCGTGAA
CGGCCACGAGTTCGAGATCGAGGGCGAGGGCGAGGGCCGCCCCTACGAGGGCACCCAGACCGCCAAGCTGAAGGTGACCA
AGGGTGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCTCAGTTCATGTACGGCTCCAAGGCCTACGTGAAGCACCCC
GCCGACATCCCCGACTACTTGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTTCGAGGACGGCGG
CGTGGTGACCGTGACCCAGGACTCCTCCCTGCAGGACGGCGAGTTCATCTACAAGGTGAAGCTGCGCGGCACCAACTTCC
CCTCCGACGGCCCCGTAATGCAGAAGAAGACCATGGGCTGGGAGGCCTCCTCCGAGCGGATGTACCCCGAGGACGGCGCC
CTGAAGGGCGAGATCAAGCAGAGGCTGAAGCTGAAGGACGGCGGCCACTACGACGCTGAGGTCAAGACCACCTACAAGGC
CAAGAAGCCCGTGCAGCTGCCCGGCGCCTACAACGTCAACATCAAGTTGGACATCACCTCCCACAACGAGGACTACACCA
TCGTGGAACAGTACGAACGCGCCGAGGGCCGCCACTCCACCGGCGGCATGGACGAGCTGTACAAG
mHoneydew Gene
gtgagcaagggcgaggaggtcatcaaggagttcatgcgcttcaaggtgcgcatggagggctccgtgaacggccacgagtt
cgagatcgagggcgagggcgagggccgcccctacgagggcacccagaccgccaagctgaaggtgaccaagggcggccccc
tgcccttcgcctgggacatcctgtcccctcagttcatgtggggctccaaggcctacgtgaagcaccccgccgacatcccc
gactacttgaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgt
gacccaggactcctccctgcaggacggcgagttcatctacaaggtgaagctgcgcggcaccaacttcccctccgacggcc
ccgtaatgcagaagaagaccatgggctgggcggccaccaccgagcggatgtaccccgaggacggcgccctgaagggcgag
atcaagatgaggctgaagctgaaggacggcggccactacgacgccgaggtcaagaccacctacatggccaagaagcccgt
gcagctgcccggcgcctacaagattgacgggaagctggacatcacctcccacaacgaggactacaccatcgtggaacagt
acgagcgcgccgagggcggccactccaccggcggcatggacgagctgtacaag
mOrange Gene
GTGAGCAAGGGCGAGGAGAATAACATGGCCATCATCAAGGAGTTCATGCGCTTCAAGGTGCGCATGGAGGGCTCCGTGAA
CGGCCACGAGTTCGAGATCGAGGGCGAGGGCGAGGGCCGCCCCTACGAGGGCTTTCAGACCGCTAAGCTGAAGGTGACCA
AGGGTGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCTCAGTTCACCTACGGCTCCAAGGCCTACGTGAAGCACCCC
GCCGACATCCCCGACTACTTCAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTTCGAGGACGGCGG
CGTGGTGACCGTGACCCAGGACTCCTCCCTGCAGGACGGCGAGTTCATCTACAAGGTGAAGCTGCGCGGCACCAACTTCC
CCTCCGACGGCCCCGTAATGCAGAAGAAGACCATGGGCTGGGAGGCCTCCTCCGAGCGGATGTACCCCGAGGACGGCGCC
CTGAAGGGCGAGATCAAGATGAGGCTGAAGCTGAAGGACGGCGGCCACTACACCTCCGAGGTCAAGACCACCTACAAGGC
CAAGAAGCCCGTGCAGCTGCCCGGCGCCTACATCGTCGGCATCAAGTTGGACATCACCTCCCACAACGAGGACTACACCA
TCGTGGAACAGTACGAACGCGCCGAGGGCCGCCACTCCACCGGCGGCATGGACGAGCTGTACAAG
mOrange2 Gene
GTGAGCAAGGGCGAGGAGAATAACATGGCCATCATCAAGGAGTTCATGCGCTTCAAGGTGCGCATGGAGGGCTCCGTGAA
CGGCCACGAGTTCGAGATCGAGGGCGAGGGCGAGGGCCGCCCCTACGAGGGCTTTCAGACCGCTAAGCTGAAGGTGACCA
AGGGTGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCTCATTTCACCTACGGCTCCAAGGCCTACGTGAAGCACCCC
GCCGACATCCCCGACTACTTCAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTACGAGGACGGCGG
CGTGGTGACCGTGACCCAGGACTCCTCCCTGCAGGACGGCGAGTTCATCTACAAGGTGAAGCTGCGCGGCACCAACTTCC
CCTCCGACGGCCCCGTGATGCAGAAGAAGACCATGGGCTGGGAGGCCTCCTCCGAGCGGATGTACCCCGAGGACGGTGCC
CTGAAGGGCAAGATCAAGATGAGGCTGAAGCTGAAGGACGGCGGCCACTACACCTCCGAGGTCAAGACCACCTACAAGGC
CAAGAAGCCCGTGCAGCTGCCCGGCGCCTACATCGTCGACATCAAGTTGGACATCACCTCCCACAACGAGGACTACACCA
TCGTGGAACAGTACGAACGCGCCGAGGGCCGCCACTCCACCGGCGGCATGGACGAGCTGTACAAG
mPlum Gene
GTGAGCAAGGGCGAGGAGGTCATCAAGGAGTTCATGCGCTTCAAGGAGCACATGGAGGGCTCCGTGAACGGCCACGAGTT
CGAGATCGAGGGCGAGGGCGAGGGCCGCCCCTACGAGGGCACCCAGACCGCCAGGCTGAAGGTGACCAAGGGTGGCCCCC
TGCCCTTCGCCTGGGACATCCTGTCCCCTCAGATCATGTACGGCTCCAAGGCCTACGTGAAGCACCCCGCCGACATCCCC
GACTACTTGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTTCGAGGACGGCGGCGTGGTGACCGT
GACCCAGGACTCCTCCCTGCAGGACGGCGAGTTCATCTACAAGGTGAAGGTGCGCGGCACCAACTTCCCCTCCGACGGCC
CCGTAATGCAGAAGAAGACCATGGGCTGGGAGGCCTCCTCCGAGCGGATGTACCCCGAGGACGGCGCCCTGAAGGGCGAG
ATGAAGATGAGGCTGAGGCTGAAGGACGGCGGCCACTACGACGCCGAGGTCAAGACCACCTACATGGCCAAGAAGCCCGT
GCAGCTGCCCGGCGCCTACAAGACCGACATCAAGCTGGACATCACCTCCCACAACGAGGACTACACCATCGTGGAACAGT
ACGAGCGCGCCGAGGGCCGCCACTCCACCGGCGCC
mRaspberry Gene
GTGAGCAAGGGCGAGGAGGTCATCAAGGAGTTCATGCGCTTCAAGGTGCGCATGGAGGGCTCCGTGAACGGCCACGAGTT
CGAGATCGAGGGCGAGGGCGAGGGCCGCCCCTACGAGGGCACCCAGACCGCCAAGCTGAAGGTGACCAAGGGTGGCCCCC
TGCCCTTCGCCTGGGACATCCTGTCCCCTCAGTGCATGTACGGCTCCAAGGGCTACGTGAAGCACCCCGCCGACATCCCC
GACTACTTGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTTCGAGGACGGCGGCGTGGTGACCGT
GACCCAGGACTCCTCCCTGCAGGACGGCGAGTTCATCTACAAGGTGAAGCTGCGCGGCACCAACTTCCCCTCCGACGGCC
CCGTAATGCAGAAGAAGACCATGGGCTGGGAGGCCTCCTCCGAGCGGATGTACCCCGAGGACGGCGCCCTGAAGGGCGAG
ATGAAGATGAGGCTGAAGCTGAAGGACGGCGGCCACTACGACGCCGAGGTCAAGACCACCTACATGGCCAAGAAGCCCGT
GCAGCTGCCCGGCGCCTACAAGACCGACATCAAGCTGGACATCACCTCCCACAACGAGGACTACACCATCGTGGAACAGT
ACGAGCGCGCCGAGGGCCGCCACTCCACCGGCGCC
mRFP1 Gene
gcctcctccgaggacgtcatcaaggagttcatgcgcttcaaggtgcgcatggagggctccgtgaacggccacgagttcga
gatcgagggcgagggcgagggccgcccctacgagggcacccagaccgccaagctgaaggtgaccaagggcggccccctgc
ccttcgcctgggacatcctgtcccctcagttccagtacggctccaaggcctacgtgaagcaccccgccgacatccccgac
tacttgaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgac
ccaggactcctccctgcaggacggcgagttcatctacaaggtgaagctgcgcggcaccaacttcccctccgacggccccg
taatgcagaagaagaccatgggctgggaggcctccaccgagcggatgtaccccgaggacggcgccctgaagggcgagatc
aagatgaggctgaagctgaaggacggcggccactacgacgccgaggtcaagaccacctacatggccaagaagcccgtgca
gctgcccggcgcctacaagaccgacatcaagctggacatcacctcccacaacgaggactacaccatcgtggaacagtacg
agcgcgccgagggccgccactccaccggcgcc
mStrawberry Gene
GTGAGCAAGGGCGAGGAGAATAACATGGCCATCATCAAGGAGTTCATGCGCTTCAAGGTGCGCATGGAGGGCTCCGTGAA
CGGCCACGAGTTCGAGATCGAGGGCGAGGGCGAGGGCCGCCCCTACGAGGGCACCCAGACCGCCAAGCTGAAGGTGACCA
AGGGTGGCCCCCTGCCCTTCGCCTGGGACATCCTAACCCCCAACTTCACCTACGGCTCCAAGGCCTACGTGAAGCACCCC
GCCGACATCCCCGACTACTTGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTTCGAGGACGGCGG
CGTGGTGACCGTGACCCAGGACTCCTCCCTGCAGGACGGCGAGTTCATCTACAAGGTGAAGCTGCGCGGCACCAACTTCC
CCTCCGACGGCCCCGTAATGCAGAAGAAGACCATGGGCTGGGAGGCCTCCTCCGAGCGGATGTACCCCGAGGACGGCGCC
CTGAAGGGCGAGATCAAGATGAGGCTGAAGCTGAAGGACGGCGGCCACTACGACGCTGAGGTCAAGACCACCTACAAGGC
CAAGAAGCCCGTGCAGCTGCCCGGCGCCTACATCGTCGGCATCAAGTTGGACATCACCTCCCACAACGAGGACTACACCA
TCGTGGAACTGTACGAACGCGCCGAGGGCCGCCACTCCACCGGCGGCATGGACGAGCTGTACAAG
mTangerine Gene
gtgagcaagggcgaggaggtcatcaaggagttcatgcgcttcaaggtgcgcatggagggctccgtgaacggccacgagtt
cgagatcgagggcgagggcgagggccgcccctacgagggcacccagaccgccaagctgaaggtgaccaagggcggccccc
tgcccttcgcctgggacatcctgtcccctcagttctgttacggctccaaggcctacgtgaagcaccccgccgacatcccc
gactacttgaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgt
gacccaggactcctccctgcaggacggcgagttcatctacaaggtgaagctgcgcggcaccaacttcccctccgacggcc
ccgtaatgcagaagaagaccatgggctgggaggcctcctccgagcggatgtaccccgaggacggcgccctgaagggcgag
atcaagatgaggctgaagctgaaggacggcggccactacgacgccgaggtcaagaccacctacatggccaagaagcccgt
gcagctgcccggcgcctacaagaccgacatcaagctggacatcacctcccacaacgaggactacaccatcgtggaattgt
acgagcgcgccgagggccgccactccaccggcggcatggacgagctgtacaag
NeoR/KanR Gene
ATGGGATCGGCCATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTTGGGTGGAGAGGCTATTCGGCTATGACTG
GGCACAACAGACAATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAAGA
CCGACCTGTCCGGTGCCCTGAATGAACTGCAGGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGGGCGTTCCTTGC
GCAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATTGGGCGAAGTGCCGGGGCAGGATCTCCTGTC
ATCTCACCTTGCTCCTGCCGAGAAAGTATCCATCATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGGCTACCT
GCCCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCGGATGGAAGCCGGTCTTGTCGATCAGGATGAT
CTGGACGAAGAGCATCAGGGGCTCGCGCCAGCCGAACTGTTCGCCAGGCTCAAGGCGCGCATGCCCGACGGCGATGATCT
CGTCGTGACCCATGGCGATGCCTGCTTGCCGAATATCATGGTGGAAAATGGCCGCTTTTCTGGATTCATCGACTGTGGCC
GGCTGGGTGTGGCGGACCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCTGAAGAGCTTGGCGGCGAATGGGCT
GACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATTCGCAGCGCATCGCCTTCTATCGCCTTCTTGACGAGTTCTT
C
pAmCherry Gene
GTGAGCAAGGGCGAGGAGGATAACATGGCCATCATTAAGGAGTTCATGCGCTTCAAGGTGCACATGGAGGGGTCCGTGAA
CGGCCACGTGTTCGAGATCGAGGGCGAGGGCGAGGGCCGCCCCTACGAGGGCACCCAGACCGCCAAGCTGAAGGTGACCA
AGGGTGGCCCCCTGCCCTTCACCTGGGACATCCTGTCCCCTCAATTCATGTACGGCTCCAATGCCTACGTGAAGCACCCC
GCCGACATCCCCGACTACTTTAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAAATTCGAGGACGGCGG
CGTGGTGACCGTGACCCAGGACTCCTCCCTGCAGGACGGTGAGTTCATCTACAAGGTGAAGCTGCGCGGCACCAACTTCC
CCTCCGACGGCCCCGTAATGCAGAAGAAGACCATGGGCTGGGAGGCCCTCTCCGAGCGGATGTACCCCGAGGACGGCGCC
CTGAAGGGCGAGGTCAAGCCGAGAGTGAAGCTGAAGGACGGCGGCCACTACGACGCTGAGGTCAAGACCACCTACAAGGC
CAAGAAGCCCGTGCAGCTGCCCGGCGCCTACAACGTCAACCGCAAGTTGGACATCACCTCACACAACGAGGACTACACCA
TCGTGGAACAGTACGAACGTGCCGAGGGCCGCCACTCCACCGGCGGCATGGACGAGCTGTACAAG
puro Gene
ATGACCGAGTACAAGCCCACGGTGCGCCTCGCCACCCGCGACGACGTCCCCCGGGCCGTACGCACCCTCGCCGCCGCGTT
CGCCGACTACCCCGCCACGCGCCACACCGTCGACCCGGACCGCCACATCGAGCGGGTCACCCGAGCTGCAAGAACTCTTC
CTCACGCGCGTCGGGCTCGACATCGGCAAGGTGTGGGTCGCGCCACACGGCGCCGCGGTGGCGGTCTGGACCACGCCGGA
GAGCGTCGAAGCGGGGGCGGTGTTCGCCGAGATCGGAACGCGCATGGCCGAGTTGAGCGGTTCCCGGCTGGCCGCGCAGC
AACAGATGGAAGGCCTCCTGGCGCCGCACCGGCCCAAGGAGCCCGCGTGGTTCCTGGCCACCGTCGGCGTCTCGCCCGAC
CACCAGGGCAAGGGTCTGGGCAGCGCCGTCGTGCTCCCCGGAGTGGAGGCGGCCGAGCGCGCCGGGGTGCCCGCCTTCCT
GGAGACCTCCGCGCCCCGCAACCTCCCTTCTACGAGCGGCTCGGCTTCACCGTCACCGCCGACGTCGAGTGCCCGAAGGA
CCGCGCGACCTGGTGCATGACCCGCAAGCCCGGTGCCTGA
sacB_neg Gene
GACGTCCACATATACCTGCCGTTCACTATTATTTAGTGAAATGAGATATTATGATATTTTCTGAATTGTGATTAAAAAGG
CAACTTTATGCCCATGCAACAGAAACTATAAAAAATACAGAGAATGAAAAGAAACAGATAGATTTTTTAGTTCTTTAGGC
CCGTAGTCTGCAAATCCTTTTATGATTTTCTATCAAACAAAAGAGGAAAATAGACCAGTTGCAATCCAAACGAGAGTCTA
ATAGAATGAGGTCGAAAAGTAAATCGCGCGGGTTTGTTACTGATAAAGCAGGCAAGACCTAAAATGTGTAAAGGGCAAAG
TGTATACTTTGGCGTCACCCCTTACATATTTTAGGTCTTTTTTTATTGTGCGTAACTAACTTGCCATCTTCAAACAGGAG
GGCTGGAAGAAGCAGACCGCTAACACAGTACATAAAAAAGGAGACATGAACGATGAACATCAAAAAGTTTGCAAAACAAG
CAACAGTATTAACCTTTACTACCGCACTGCTGGCAGGAGGCGCAACTCAAGCGTTTGCGAAAGAAACGAACCAAAAGCCA
TATAAGGAAACATACGGCATTTCCCATATTACACGCCATGATATGCTGCAAATCCCTGAACAGCAAAAAAATGAAAAATA
TCAAGTTCCTGAGTTCGATTCGTCCACAATTAAAAATATCTCTTCTGCAAAAGGCCTGGACGTTTGGGACAGCTGGCCAT
TACAAAACGCTGACGGCACTGTCGCAAACTATCACGGCTACCACATCGTCTTTGCATTAGCCGGAGATCCTAAAAATGCG
GATGACACATCGATTTACATGTTCTATCAAAAAGTCGGCGAAACTTCTATTGACAGCTGGAAAAACGCTGGCCGCGTCTT
TAAAGACAGCGACAAATTCGATGCAAATGATTCTATCCTAAAAGACCAAACACAAGAATGGTCAGGTTCAGCCACATTTA
CATCTGACGGAAAAATCCGTTTATTCTACACTGATTTCTCCGGTAAACATTACGGCAAACAAACACTGACAACTGCACAA
GTTAACGTATCAGCATCAGACAGCTCTTTGAACATCAACGGTGTAGAGGATTATAAATCAATCTTTGACGGTGACGGAAA
AACGTATCAAAATGTACAGCAGTTCATCGATGAAGGCAACTACAGCTCAGGCGACAACCATACGCTGAGAGATCCTCACT
ACGTAGAAGATAAAGGCCACAAATACTTAGTATTTGAAGCAAACACTGGAACTGAAGATGGCTACCAAGGCGAAGAATCT
TTATTTAACAAAGCATACTATGGCAAAAGCACATCATTCTTCCGTCAAGAAAGTCAAAAACTTCTGCAAAGCGATAAAAA
ACGCACGGCTGAGTTAGCAAACGGCGCTCTCGGTATGATTGAGCTAAACGATGATTACACACTGAAAAAAGTGATGAAAC
CGCTGATTGCATCTAACACAGTAACAGATGAAATTGAACGCGCGAACGTCTTTAAAATGAACGGCAAATGGTACCTGTTC
ACTGACTCCCGCGGATCAAAAATGACGATTGACGGCATTACGTCTAACGATATTTACATGCTTGGTTATGTTTCTAATTC
TTTAACTGGCCCATACAAGCCGCTGAACAAAACTGGCCTTGTGTTAAAAATGGATCTTGATCCTAACGATGTAACCTTTA
CTTACTCACACTTCGCTGTACCTCAAGCGAAAGGAAACAATGTCGTGATTACAAGCTATATGACAAACAGAGGATTCTAC
GCAGACAAACAATCAACGTTTGCGCCTAGCTTCCTGCTGAACATCAAAGGCAAGAAAACATCTGTTGTCAAAGACAGCAT
CCTTGAACAAGGACAATTAACAGTTAACAAATAAAAACGCAAAAGAAAATGCCGATATCCTATTGGCATTG
spect Gene
ATGCGCTCACGCAACTGGTCCAGAACCTTGACCGAACGCAGCGGTGGTAACGGCGCAGTGGCGGTTTTCATGGCTTGTTA
TGACTGTTTTTTTGGGGTACAGTCTATGCCTCGGGCATCCAAGCAGCAAGCGCGTTACGCCGTGGGTCGATGTTTGATGT
TATGGAGCAGCAACGATGTTACGCAGCAGGGCAGTCGCCCTAAAACAAAGTTAAACATCATGAGGGAAGCGGTGATCGCC
GAAGTATCGACTCAACTATCAGAGGTAGTTGGCGTCATCGAGCGCCATCTCGAACCGACGTTGCTGGCCGTACATTTGTA
CGGCTCCGCAGTGGATGGCGGCCTGAAGCCACACAGTGATATTGATTTGCTGGTTACGGTGACCGTAAGGCTTGATGAAA
CAACGCGGCGAGCTTTGATCAACGACCTTTTGGAAACTTCGGCTTCCCCTGGAGAGAGCGAGATTCTCCGCGCTGTAGAA
GTCACCATTGTTGTGCACGACGACATCATTCCGTGGCGTTATCCAGCTAAGCGCGAACTGCAATTTGGAGAATGGCAGCG
CAATGACATTCTTGCAGGTATCTTCGAGCCAGCCACGATCGACATTGATCTGGCTATCTTGCTGACAAAAGCAAGAGAAC
ATAGCGTTGCCTTGGTAGGTCCAGCGGCGGAGGAACTCTTTGATCCGGTTCCTGAACAGGATCTATTTGAGGCGCTAAAT
GAAACCTTAACGCTATGGAACTCGCCGCCCGACTGGGCTGGCGATGAGCGAAATGTAGTGCTTACGTTGTCCCGCATTTG
GTACAGCGCAGTAACCGGCAAAATCGCGCCGAAGGATGTCGCTGCCGACTGGGCAATGGAGCGCCTGCCGGCCCAGTATC
AGCCCGTCATACTTGAAGCTAGACAGGCTTATCTTGGACAAGAAGAAGATCGCTTGGCCTCGCGCGCAGATCAGTTGGAA
GAATTTGTCCACTACGTGAAAGGCGAGATCACCAAGGTAGTCGGCAAATAA
spect Gene
GTGAGGAGGATATATTTGAATACATACGAACAAATTAATAAAGTGAAAAAAATACTTCGGAAACATTTAAAAAATAACCT
TATTGGTACTTACATGTTTGGATCAGGAGTTGAGAGTGGACTAAAACCAAATAGTGATCTTGACTTTTTAGTCGTCGTAT
CTGAACCATTGACAGATCAAAGTAAAGAAATACTTATACAAAAAATTAGACCTATTTCAAAAAAAATAGGAGATAAAAGC
AACTTACGATATATTGAATTAACAATTATTATTCAGCAAGAAATGGTACCGTGGAATCATCCTCCCAAACAAGAATTTAT
TTATGGAGAATGGTTACAAGAGCTTTATGAACAAGGATACATTCCTCAGAAGGAATTAAATTCAGATTTAACCATAATGC
TTTACCAAGCAAAACGAAAAAATAAAAGAATATACGGAAATTATGACTTAGAGGAATTACTACCTGATATTCCATTTTCT
GATGTGAGAAGAGCCATTATGGATTCGTCAGAGGAATTAATAGATAATTATCAGGATGATGAAACCAACTCTATATTAAC
TTTATGCCGTATGATTTTAACTATGGACACGGGTAAAATCATACCAAAAGATATTGCGGGAAATGCAGTGGCTGAATCTT
CTCCATTAGAACATAGGGAGAGAATTTTGTTAGCAGTTCGTAGTTATCTTGGAGAGAATATTGAATGGACTAATGAAAAT
GTAAATTTAACTATAAACTATTTAAATAACAGATTAAAAAAATTATAA
SpHis5 Gene
atgaggagggcttttgtagaaagaaatacgaacgaaacgaaaatcagcgttgccatcgctttggacaaagctcccttacc
tgaagagtcgaattttattgatgaacttataacttccaagcatgcaaaccaaaagggagaacaagtaatccaagtagaca
cgggaattggattcttggatcacatgtatcatgcactggctaaacatgcaggctggagcttacgactttactcaagaggt
gatttaatcatcgatgatcatcacactgcagaagatactgctattgcacttggtattgcattcaagcaggctatgggtaa
ctttgccggcgttaaaagatttggacatgcttattgtccacttgacgaagctctttctagaagcgtagttgacttgtcgg
gacggccctatgctgttatcgatttgggattaaagcgtgaaaaggttggggaattgtcctgtgaaatgatccctcactta
ctatattccttttcggtagcagctggaattactttgcatgttacctgcttatatggtagtaatgaccatcatcgtgctga
aagcgcttttaaatctctggctgttgccatgcgcgcggctactagtcttactggaagttctgaagtcccaagcacgaagg
gagtgttgtaa
tdimer2 Gene
gtggcctcctccgaggacgtcatcaaagagttcatgcgcttcaaggtgcgcatggagggctccgtgaacggccacgagtt
cgagatcgagggcgagggcgagggccgcccctacgagggcacccagaccgccaagctgaaggtgaccaagggcggccccc
tgcccttcgcctgggacatcctgtccccccagttccagtacggctccaaggcgtacgtgaagcaccccgccgacatcccc
gactacaagaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgt
gacccaggactcctccctgcaggacggcacgctgatctacaaggtgaagttccgcggcaccaacttcccccccgacggcc
ccgtaatgcagaagaagaccatgggctgggaggcctccaccgagcgcctgtacccccgcgacggcgtgctgaagggcgag
atccaccaggccctgaagctgaaggacggcggccactacctggtggagttcaagaccatctacatggccaagaagcccgt
gcagctgcccggctactactacgtggacaccaagctggacatcacctcccacaacgaggactacaccatcgtggaacagt
acgagcgctccgagggccgccaccacctgttcctg
tet Gene
ATGAAATCTAACAATGCGCTCATCGTCATCCTCGGCACCGTCACCCTGGATGCTGTAGGCATAGGCTTGGTTATGCCGGT
ACTGCCGGGCCTCTTGCGGGATATCGTCCATTCCGACAGCATCGCCAGTCACTATGGCGTGCTGCTAGCGCTATATGCGT
TGATGCAATTTCTATGCGCACCCGTTCTCGGAGCACTGTCCGACCGCTTTGGCCGCCGCCCAGTCCTGCTCGCTTCGCTA
CTTGGAGCCACTATCGACTACGCGATCATGGCGACCACACCCGTCCTGTGGATTCTCTACGCCGGACGCATCGTGGCCGG
CATCACCGGCGCCACAGGTGCGGTTGCTGGCGCCTATATCGCCGACATCACCGATGGGGAAGATCGGGCTCGCCACTTCG
GGCTCATGAGCGCTTGTTTCGGCGTGGGTATGGTGGCAGGCCCCGTGGCCGGGGGACTGTTGGGCGCCATCTCCTTACAT
GCACCATTCCTTGCGGCGGCGGTGCTCAACGGCCTCAACCTACTACTGGGCTGCTTCCTAATGCAGGAGTCGCATAAGGG
AGAGCGCCGACCCATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCATGACTATCGTCGCCG
CACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCCGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGC
TTTCGCTGGAGCGCGACGATGATCGGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCAC
TGGTCCCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCTGGGCTACGTCTTGC
TGGCGTTCGCGACGCGAGGCTGGATGGCCTTCCCCATTATGATTCTTCTCGCTTCCGGCGGCATCGGGATGCCCGCGTTG
CAGGCCATGCTGTCCAGGCAGGTAGATGACGACCATCAGGGACAGCTTCAAGGATCGCTCGCGGCTCTTACCAGCCTAAC
TTCGATCATTGGACCGCTGATCGTCACGGCGATTTATGCCGCCTCGGCGAGCACATGGAACGGGTTGGCATGGATTGTAG
GCGCCGCCCTATACCTTGTCTGCCTCCCCGCGTTGCGTCGCGGTGCATGGAGCCGGGCCACCTCGACCTGA
Timer Gene
GTGCGCTCCTCCAAGAACGTCATCAAGGAGTTCATGCGCTTCAAGGTGCGCATGGAGGGCACCGTGAACGGCCACGAGTT
CGAGATCGAGGGCGAGGGCGAGGGCCGCCCCTACGAGGGCCACAACACCGTGAAGCTGAAGGTGACCAAGGGCGGCCCCC
TGCCCTTCGCCTGGGACATCCTGTCCCCCCAGTTCCAGTACGGCTCCAAGGTGTACGTGAAGCACCCCGCCGACATCCCC
GACTACAAGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTTCGAGGACGGCGGCGTGGCGACCGT
GACCCAGGACTCCTCCCTGCAGGACGGCTGCTTCATCTACAAGGTGAAGTTCATCGGCGTGAACTTCCCCTCCGACGGCC
CCGTGATGCAGAAGAAGACCATGGGCTGGGAGGCCTCCACCGAGCGCCTGTACCCCCGCGACGGCGTGCTGAAGGGCGAG
ATCCACAAGGCCCTGAAGCTGAAGGACGGCGGCCACTACCTGGTGGAGTTCAAGTCCATCTACATGGCCAAGAAGCCCGT
GCAGCTGCCCGGCTACTACTACGTGGACACCAAGCTGGACATCACCTCCCACAACGAGGACTACACCATCGTGGAGCAGT
ACGAGCGCACCGAGGGCCGCCACCACCTGTTCCTG
TRP1 Gene
ATGTCTGTTATTAATTTCACAGGTAGTTCTGGTCCATTGGTGAAAGTTTGCGGCTTGCAGAGCACAGAGGCCGCAGAATG
TGCTCTAGATTCCGATGCTGACTTGCTGGGTATTATATGTGTGCCCAATAGAAAGAGAACAATTGACCCGGTTATTGCAA
GGAAAATTTCAAGTCTTGTAAAAGCATATAAAAATAGTTCAGGCACTCCGAAATACTTGGTTGGCGTGTTTCGTAATCAA
CCTAAGGAGGATGTTTTGGCTCTGGTCAATGATTACGGCATTGATATCGTCCAACTGCATGGAGATGAGTCGTGGCAAGA
ATACCAAGAGTTCCTCGGTTTGCCAGTTATTAAAAGACTCGTATTTCCAAAAGACTGCAACATACTACTCAGTGCAGCTT
CACAGAAACCTCATTCGTTTATTCCCTTGTTTGATTCAGAAGCAGGTGGGACAGGTGAACTTTTGGATTGGAACTCGATT
TCTGACTGGGTTGGAAGGCAAGAGAGCCCCGAAAGCTTACATTTTATGTTAGCTGGTGGACTGACGCCAGAAAATGTTGG
TGATGCGCTTAGATTAAATGGCGTTATTGGTGTTGATGTAAGCGGAGGTGTGGAGACAAATGGTGTAAAAGACTCTAACA
AAATAGCAAATTTCGTCAAAAATGCTAAGAAATAG
trpE Gene
ATGCAAACACAAAAACCGACTCTCGAACTGCTAACCTGCGAAGGCGCTTATCGCGACAATCCCACCGCGCTTTTTCACCA
GTTGTGTGGGGATCGTCCGGCAACGCTGCTGCTGGAATCCGCAGATATCGACAGCAAAGATGATTTAAAAAGCCTGCTGC
TGGTAGACAGTGCGCTGCGCATTACAGCTTTAGGTGACACTGTCACAATCCAGGCACTTTCCGGCAACGGCGAAGCCCTC
CTGGCACTACTGGATAACGCCCTGCCTGCGGGTGTGGAAAGTGAACAATCACCAAACTGCCGTGTGCTGCGCTTCCCCCC
TGTCAGTCCACTGCTGGATGAAGACGCCCGCTTATGCTCCCTTTCGGTTTTTGACGCTTTCCGTTTATTGCAGAATCTGT
TGAATGTACCGAAGGAAGAACGAGAAGCCATGTTCTTCAGCGGCCTGTTCTCTTATGACCTTGTGGCGGGATTTGAAGAT
TTACCGCAACTGTCAGCGGAAAATAACTGCCCTGATTTCTGTTTTTATCTCGCTGAAACGCTGATGGTGATTGACCATCA
GAAAAAAAGCACCCGTATTCAGGCCAGCCTGTTTGCTCCGAATGAAGAAGAAAAACAACGTCTCACTGCTCGCCTGAACG
AACTACGTCAGCAACTGACCGAAGCCGCGCCGCCGCTGCCAGTGGTTTCCGTGCCGCATATGCGTTGTGAATGTAATCAG
AGCGATGAAGAGTTCGGTGGCGTAGTGCGTTTGTTGCAAAAAGCGATTCGCGCTGGAGAAATTTTCCAGGTGGTGCCATC
TCGCCGTTTCTCTCTGCCCTGCCCGTCACCGCTGGCGGCCTATTACGTGCTGAAAAAGAGTAATCCCAGCCCGTACATGT
TTTTTATGCAGGATAATGATTTCACCCTATTTGGCGCGTCGCCGGAAAGCTCGCTCAAGTATGATGCCACCAGCCGCCAG
ATTGAGATCCCCCGGAATTCGAGCTCGCCCGGGGATCCTCTAGAGTCGACCTGCAGCCCAAGCTTATCGATGATAAGCTG
TCAAACATGA
URA3 Gene
ATGTCGAAAGCTACATATAAGGAACGTGCTGCTACTCATCCTAGTCCTGTTGCTGCCAAGCTATTTAATATCATGCACGA
AAAGCAAACAAACTTGTGTGCTTCATTGGATGTTCGTACCACCAAGGAATTACTGGAGTTAGTTGAAGCATTAGGTCCCA
AAATTTGTTTACTAAAAACACATGTGGATATCTTGACTGATTTTTCCATGGAGGGCACAGTTAAGCCGCTAAAGGCATTA
TCCGCCAAGTACAATTTTTTACTCTTCGAAGACAGAAAATTTGCTGACATTGGTAATACAGTCAAATTGCAGTACTCTGC
GGGTGTATACAGAATAGCAGAATGGGCAGACATTACGAATGCACACGGTGTGGTGGGCCCAGGTATTGTTAGCGGTTTGA
AGCAGGCGGCAGAAGAAGTAACAAAGGAACCTAGAGGCCTTTTGATGTTAGCAGAATTGTCATGCAAGGGCTCCCTATCT
ACTGGAGAATATACTAAGGGTACTGTTGACATTGCGAAGAGCGACAAAGATTTTGTTATCGGCTTTATTGCTCAAAGAGA
CATGGGTGGAAGAGATGAAGGTTACGATTGGTTGATTATGACACCCGGTGTGGGTTTAGATGACAAGGGAGACGCATTGG
GTCAACAGTATAGAACCGTGGATGATGTGGTCTCTACAGGATCTGACATTATTATTGTTGGAAGAGGACTATTTGCAAAG
GGAAGGGATGCTAAGGTAGAGGGTGAACGTTACAGAAAAGCAGGCTGGGAAGCATATTTGAGAAGATGCGGCCAGCAAAA
C
vsv-G Gene
atgaagtgccttttgtacttagcctttttattcattggggtgaattgcaagttcaccatagtttttccacacaaccaaaa
aggaaactggaaaaatgttccttctaattaccattattgcccgtcaagctcagatttaaattggcataatgacttaatag
gcacagccttacaagtcaaaatgcccaagagtcacaaggctattcaagcagacggttggatgtgtcatgcttccaaatgg
gtcactacttgtgatttccgctggtatggaccgaagtatataacacattccatccgatccttcactccatctgtagaaca
atgcaaggaaagcattgaacaaacgaaacaaggaacttggctgaatccaggcttccctcctcaaagttgtggatatgcaa
ctgtgacggatgccgaagcagtgattgtccaggtgactcctcaccatgtgctggttgatgaatacacaggagaatgggtt
gattcacagttcatcaacggaaaatgcagcaattacatatgccccactgtccataactctacaacctggcattctgacta
taaggtcaaagggctatgtgattctaacctcatttccatggacatcaccttcttctcagaggacggagagctatcatccc
tgggaaaggagggcacagggttcagaagtaactactttgcttatgaaactggaggcaaggcctgcaaaatgcaatactgc
aagcattggggagtcagactcccatcaggtgtctggttcgagatggctgataaggatctctttgctgcagccagattccc
tgaatgcccagaagggtcaagtatctctgctccatctcagacctcagtggatgtaagtctaattcaggacgttgagagga
tcttggattattccctctgccaagaaacctggagcaaaatcagagcgggtcttccaatctctccagtggatctcagctat
cttgctcctaaaaacccaggaaccggtcctgctttcaccataatcaatggtaccctaaaatactttgagaccagatacat
cagagtcgatattgctgctccaatcctctcaagaatggtcggaatgatcagtggaactaccacagaaagggaactgtggg
atgactgggcaccatatgaagacgtggaaattggacccaatggagttctgaggaccagttcaggatataagtttccttta
tacatgattggacatggtatgttggactccgatcttcatcttagctcaaaggctcaggtgttcgaacatcctcacattca
agacgctgcttcgcaacttcctgatgatgagagtttattttttggtgatactgggctatccaaaaatccaatcgagcttg
tagaaggttggttcagtagttggaaaagctctattgcctcttttttctttatcatagggttaatcattggactattcttg
gttctccgagttggtatccatctttgcattaaattaaagcacaccaagaaaagacagatttatacagacatagagatgaa
ccgacttggaaagtga
zeo Gene
TTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATGTGAGG
AGGGCCACCATGGCCAAGTTGACCAGTGCCGTTCCGGTGCTCACCGCGCGCGACGTCGCCGGAGCGGTCGAGTTCTGGAC
CGACCGGCTCGGGTTCTCCCGGGACTTCGTGGAGGACGACTTCGCCGGTGTGGTCCGGGACGACGTGACCCTGTTCATCA
GCGCGGTCCAGGACCAGGTGGTGCCGGACAACACCCTGGCCTGGGTGTGGGTGCGCGGCCTGGACGAGCTGTACGCCGAG
TGGTCGGAGGTCGTGTCCACGAACTTCCGGGACGCCTCCGGGCCGGCCATGACCGAGATCGGCGAGCAGCCGTGGGGGCG
GGAGTTCGCCCTGCGCGACCCGGCCGGCAACTGCGTGCACTTCGTGGCCGAGGAGCAGGACTGA
Zs_Green Gene
GCCCAGTCCAAGCACGGCCTGACCAAGGAGATGACCATGAAGTACCGCATGGAGGGCTGCGTGGACGGCCACAAGTTCGT
GATCACCGGCGAGGGCATCGGCTACCCCTTCAAGGGCAAGCAGGCCATCAACCTGTGCGTGGTGGAGGGCGGCCCCTTGC
CCTTCGCCGAGGACATCTTGTCCGCCGCCTTCATGTACGGCAACCGCGTGTTCACCGAGTACCCCCAGGACATCGTCGAC
TACTTCAAGAACTCCTGCCCCGCCGGCTACACCTGGGACCGCTCCTTCCTGTTCGAGGACGGCGCCGTGTGCATCTGCAA
CGCCGACATCACCGTGAGCGTGGAGGAGAACTGCATGTACCACGAGTCCAAGTTCTACGGCGTGAACTTCCCCGCCGACG
GCCCCGTGATGAAGAAGATGACCGACAACTGGGAGCCCTCCTGCGAGAAGATCATCCCCGTGCCCAAGCAGGGCATCTTG
AAGGGCGACGTGAGCATGTACCTGCTGCTGAAGGACGGTGGCCGCTTGCGCTGCCAGTTCGACACCGTGTACAAGGCCAA
GTCCGTGCCCCGCAAGATGCCCGACTGGCACTTCATCCAGCACAAGCTGACCCGCGAGGACCGCAGCGACGCCAAGAACC
AGAAGTGGCACCTGACCGAGCACGCCATCGCCTCCGGCTCCGCCTTGCCC
Zs_Yellow Gene
gcccacagcaagcacggcctgaaggaggagatgaccatgaagtaccacatggagggctgcgtgaacggccacaagttcgt
gatcaccggcgagggcatcggctaccccttcaagggcaagcagaccatcaacctgtgcgtgatcgagggcggccccctgc
ccttcagcgaggacatcctgagcgccggcttcaagtacggcgaccggatcttcaccgagtacccccaggacatcgtggac
tacttcaagaacagctgccccgccggctacacctggggccggagcttcctgttcgaggacggcgccgtgtgcatctgtaa
cgtggacatcaccgtgagcgtgaaggagaactgcatctaccacaagagcatcttcaacggcgtgaacttccccgccgacg
gccccgtgatgaagaagatgaccaccaactgggaggccagctgcgagaagatcatgcccgtgcctaagcagggcatcctg
aagggcgacgtgagcatgtacctgctgctgaaggacggcggccggtaccggtgccagttcgacaccgtgtacaaggccaa
gagcgtgcccagcaagatgcccgagtggcacttcatccagcacaagctgctgcgggaggaccggagcgacgccaagaacc
agaagtggcagctgaccgagcacgccatcgccttccccagcgccctggcc
2micron2_origin Origin
ACGCATTTAAGCATAAACACGCACTATGCCGTTCTTCTCATGTATATATATATACAGGCAACACGCAGATATAGGTGCGA
CGTGAACAGTGAGCTGTATGTGCGCAGCTCGCGTTGCATTTTCGGAAGCGCTCGTTTTCGGAAACGCTTTGAAGTTCCTA
TTCCGAAGTTCCTATTCTCTAGCTAGAAAGTATAGGAACTTCAGAGCGCTTTTGAAAACCAAAAGCGCTCTGAAGACGCA
CTTTCAAAAAACCAAAAACGCACCGGACTGTAACGAGCTACTAAAATATTGCGAATACCGCTTCCACAAACATTGCTCAA
AAGTATCTCTTTGCTATATATCTCTGTGCTATATCCCTATATAACCTACCCATCCACCTTTCGCTCCTTGAACTTGCATC
TAAACTCGACCTCTACATTTTTTATGTTTATCTCTAGTATTACTCTTTAGACAAAAAAATTGTAGTAAGAACTATTCATA
GAGTGAATCGAAAACAATACGAAAATGTAAACATTTCCTATACGTAGTATATAGAGACAAAATAGAAGAAACCGTTCATA
ATTTTCTGACCAATGAAGAATCATCAACGCTATCACTTTCTGTTCACAAAGTATGCGCAATCCACATCGGTATAGAATAT
AATCGGGGATGCCTTTATCTTGAAAAAATGCACCCGCAGCTTCGCTAGTAATCAGTAAACGCGGGAAGTGGAGTCAGGCT
TTTTTTATGGAAGAGAAAATAGACACCAAAGTAGCCTTCTTCTAACCTTAACGGACCTACAGTGCAAAAAGTTATCAAGA
GACTGCATTATAGAGCGCACAAAGGAGAAAAAAAGTAATCTAAGATGCTTTGTTAGAAAAATAGCGCTCTCGGGATGCAT
TTTTGTAGAACAAAAAAGAAGTATAGATTCTTTGTTGGTAAAATAGCGCTCTCGCGTTGCATTTCTGTTCTGTAAAAATG
CAGCTCAGATTCTTTGTTTGAAAAATTAGCGCTCTCGCGTTGCATTTTTGTTTTACAAAAATGAAGCACAGATTCTTCGT
TGGTAAAATAGCGCTTTCGCGTTGCATTTCTGTTCTGTAAAAATGCAGCTCAGATTCTTTGTTTGAAAAATTAGCGCTCT
CGCGTTGCATTTTTGTTCTACAAAATGAAGCACAGATGCTTCGTT
2micron_origin Origin
TTATCGATGATAAGCTGTCAAAGATGAGAATTAATTCCACGGACTATAGACTATACTAGATACTCCGTCTACTGTACGAT
ACACTTCCGCTCAGGTCCTTGTCCTTTAACGAGGCCTTACCACTCTTTTGTTACTCTATTGATCCAGCTCAGCAAAGGCA
GTGTGATCTAAGATTCTATCTTCGCGATGTAGTAAAACTAGCTAGACCGAGAAAGAGACTAGAAATGCAAAAGGCACTTC
TACAATGGCTGCCATCATTATTATCCGATGTGACGCTGCAGCTTCTCAATGATATTCGAATACGCTTTGAGGAGATACAG
CCTAATATCCGACAAACTGTTTTACAGATTTACGATCGTACTTGTTACCCATCATTGAATTTTGAACATCCGAACCTGGG
AGTTTTCCCTGAAACAGATAGTATATTTGAACCTGTATAATAATATATAGTCTAGCGCTTTACGGAAGACAATGTATGTA
TTTCGGTTCCTGGAGAAACTATTGCATCTATTGCATAGGTAATCTTGCACGTCGCATCCCCGGTTCATTTTCTGCGTTTC
CATCTTGCACTTCAATAGCATATCTTTGTTAACGAAGCATCTGTGCTTCATTTTGTAGAACAAAAATGCAACGCGAGAGC
GCTAATTTTTCAAACAAAGAATCTGAGCTGCATTTTTACAGAACAGAAATGCAACGCGAAAGCGCTATTTTACCAACGAA
GAATCTGTGCTTCATTTTTGTAAAACAAAAATGCAACGCGACGAGAGCGCTAATTTTTCAAACAAAGAATCTGAGCTGCA
TTTTTACAGAACAGAAATGCAACGCGAGAGCGCTATTTTACCAACAAAGAATCTATACTTCTTTTTTGTTCTACAAAAAT
GCATCCCGAGAGCGCTATTTTTCTAACAAAGCATCTTAGATTACTTTTTTTCTCCTTTGTGCGCTCTATAATGCAGTCTC
TTGATAACTTTTTGCACTGTAGGTCCGTTAAGGTTAGAAGAAGGCTACTTTGGTGTCTATTTTCTCTTCCATAAAAAAAG
CCTGACTCCACTTCCCGCGTTTACTGATTACTAGCGAAGCTGCGGGTGCATTTTTTCAAGATAAAGGCATCCCCGATTAT
ATTCTATACCGATGTGGATTGCGCATACTTTGTGAACAGAAAGTGATAGCGTTGATGATTCTTCATTGGTCAGAAAATTA
TGAACGGTTTCTTCTATTTTGTCTCTATATACTACGTATAGGAAATGTTTACATTTTCGTATTGTTTTCGATTCACTCTA
TGAATAGTTCTTACTACAATTTTTTTGTCTAAAGAGTAATACTAGAGATAAACATAAAAAATGTAGAGGTCGAGTTTAGA
TGCAAGTTCAAGGAGCGAAAGGTGGATGGGTAGGTTATATAGGGATATAGCACAGAGATATATAGCAAAGAGATACTTTT
GAGCAATGTTTGTGGAAGCGGTATTCGCAATG
EBV_origin Origin
CATTAAACGGCATGCAGGAAAAGGACAAGCAGCGAAAATTCACGCCCCCTTGGGAGGTGGCGGCATATGCAAAGGATAGC
ACTCCCACTCTACTACTGGGTATCATATGCTGACTGTATATGCATGAGGATAGCATATGCTACCCGGATACAGATTAGGA
TAGCATATACTACCCAGATATAGATTAGGATAGCATATGCTACCCAGATATAGATTAGGATAGCCTATGCTACCCAGATA
TAAATTAGGATAGCATATACTACCCAGATATAGATTAGGATAGCATATGCTACCCAGATATAGATTAGGATAGCCTATGC
TACCCAGATATAGATTAGGATAGCATATGCTACCCAGATATAGATTAGGATAGCATATGCTATCCAGATATTTGGGTAGT
ATATGCTACCCAGATATAAATTAGGATAGCATATACTACCCTAATCTCTATTAGGATAGCATATGCTACCCGGATACAGA
TTAGGATAGCATATACTACCCAGATATAGATTAGGATAGCATATGCTACCCAGATATAGATTAGGATAGCCTATGCTACC
CAGATATAAATTAGGATAGCATATACTACCCAGATATAGATTAGGATAGCATATGCTACCCAGATATAGATTAGGATAGC
CTATGCTACCCAGATATAGATTAGGATAGCATATGCTATCCAGATATTTGGGTAGTATATGCTACCCATGGCAACATTAG
CCCACCGTGCTCTCAGCGACCTCGTGAATATGAGGACCAACAACCCTGTGCTTGGCGCTCAGGCGCAAGTGTGTGTAATT
TGTCCTCCAGATCGCAGCAATCGCGCCCCTATCTTGGCCCGCCCACCTACTTATGCAGGTATTCCCCGGGGTGCCATTAG
TGGTTTTGTGGGCAAGTGGTTTGACCGCAGTGGTTAGCGGGGTTACAATCAGCCAAGTTATTACACCCTTATTTTACAGT
CCAAAACCGCAGGGCGGCGTGTGGGGGCTGACGCGTGCCCCCACTCCACAATTTCAAAAAAAAGAGTGGCCACTTGTCTT
TGTTTATGGGCCCCATTGGCGTGGAGCCCCGTTTAATTTTCGGGGGTGTTAGAGACAACCAGTGGAGTCCGCTGCTGTCG
GCGTCCACTCTCTTTCCCCTTGTTACAAATAGAGTGTAACAACATGGTTCACCTGTCTTGGTCCCTGCCTGGGACACATC
TTAATAACCCCAGTATCATATTGCACTAGGATTATGTGTTGCCCATAGCCATAAATTCGTGTGAGATGGACATCCAGTCT
TTACGGCTTGTCCCCACCCCATGGATTTCTATTGTTAAAGATATTCAGAATGTTTCATTCCTACACTAGTATTTATTGCC
CAAGGGGTTTGTGAGGGTTATATTGGTGTCATAGCACAATGCCACCACTGAACCCCCCGTCCAAATTTTATTCTGGGGGC
GTCACCTGAAACCTTGTTTTCGAGCACCTCACATACACCTTACTGTTCACAACTCAGCAGTTATTCTATTAGCTAAACGA
AGGAGAATGAAGAAGCAGGCGAAGATTCAGGAGAGTTCACTGCCCGCTCCTTGATCTTCAGCCACTGCCCTTGTGACTAA
AATGGTTCACTACCCTCGTGGAATCCTGACCCCATGTAAATAAAACCGTGACAGCTCATGGGGTGGGAGATATCGCTGTT
CCTTAGGACCCTTTTACTAACCCTAATTCGATAGCATATGCTTCCCGTTGGGTAACATATGCTATTGAATTAGGGTTAGT
CTGGATAGTATATACTACTACCCGGGAAGCATATGCTACCCGTTTAGGGTTAACAAGGGGGCCTTATAAACACTATTGCT
AATGCCCTCTTGAGGGTCCGCTTATCGGTAGCTACACAGGCCCCTCTGATTGACGTTGGTGTAGCCTCCCGTAGTCTTCC
TGGGCCCCTGGGAGGTACATGTCCCCCAGCATTGGTGTAAGAGCTTCAGCCAAGAGTTACACATAAAGGCAATGTTGTGT
TGCAGTCCACAGACTGCAAAGTCTGCTCCAGGATGAAAGCCACTCAGTGTTGGCAAATGTGCACATCCATTTATAAGGAT
GTCAACTACAGTCAGAGAACCCCTTTGTGTTTGGTCCCCCCCCGTGTCACATGTGGAACAGGGCCCAGTTGGCAAGTTGT
ACCAACCAACTGAAGGGATTACA
f1_origin Origin
GCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGC
TTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGAT
TTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTTGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACG
GTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAA
oriT_RP4 Origin
gaataagggacagtgaagaaggaacacccgctcgcgggtgggcctacttcacctatcctgcccggctgacgccgttggat
acaccaaggaaagtctaca
p15A_origin Origin
GCGCTAGCGGAGTGTATACTGGCTTACTATGTTGGCACTGATGAGGGTGTCAGTGAAGTGCTTCATGTGGCAGGAGAAAA
AAGGCTGCACCGGTGCGTCAGCAGAATATGTGATACAGGATATATTCCGCTTCCTCGCTCACTGACTCGCTACGCTCGGT
CGTTCGACTGCGGCGAGCGGAAATGGCTTACGAACGGGGCGGAGATTTCCTGGAAGATGCCAGGAAGATACTTAACAGGG
AAGTGAGAGGGCCGCGGCAAAGCCGTTTTTCCATAGGCTCCGCCCCCCTGACAAGCATCACGAAATCTGACGCTCAAATC
AGTGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGCGGCTCCCTCGTGCGCTCTCCTGTTCCT
GCCTTTCGGTTTACCGGTGTCATTCCGCTGTTATGGCCGCGTTTGTCTCATTCCACGCCTGACACTCAGTTCCGGGTAGG
CAGTTCGCTCCAAGCTGGACTGTATGCACGAACCCCCCGTTCAGTCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTT
GAGTCCAACCCGGAAAGACATGCAAAAGCACCACTGGCAGCAGCCACTGGTAATTGATTTAGAGGAGTTAGTCTTGAAGT
CATGCGCCGGTTAAGGCTAAACTGAAAGGACAAGTTTTGGTGACTGCGCTCCTCCAAGCCAGTTACCTCGGTTCAAAGAG
TTGGTAGCTCAGAGAACCTTCGAAAAACCGCCCTGCAAGGCGGTTTTTTCGTTTTCAGAGCAAGAGATTACGCGCAGACC
AAAACGATCTCAAGAAGATCATCTTATTAATCAGATAAAATATTTCTAGATTTCAGTGCAATTTATCTCTTCAAATGTAG
CACCTGAAGTCAGCCCCATACGATATAAGTTGT
pBR322_origin Origin
AGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCG
GTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATAC
TGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCC
TGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCG
CAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACA
GCGTGAGCATTGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAG
GAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAG
CGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCG
R6Kg_origin Origin
CCATGTCAGCCGTTAAGTGTTCCTGTGTCACTCAAAATTGCTTTGAGAGGCTCTAAGGGCTTCTCAGTGCGTTACATCCC
TGGCTTGTTGTCCACAACCGTTAAACCTTAAAAGCTTTAAAAGCCTTATATATTCTTTTTTTTCTTATAAAACTTAAAAC
CTTAGAGGCTATTTAAGTTGCTGATTTATATTAATTTTATTGTTCAAACATGAGAGCTTAGTACGTGAAACATGAGAGCT
TAGTACGTTAGCCATGAGAGCTTAGTACGTTAGCCATGAGGGTTTAGTTCGTTAAACATGAGAGCTTAGTACGTTAAACA
TGAGAGCTTAGTACGTGAAACATGAGAGCTTAGTACGTACTATCAACAGGTTGAACTGCTGATCAACAGATC
SV40_origin Origin
ATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCC
3MoMuLV_LTR Regulatory
AATGAAAGACCCCACCTGTAGGTTTGGCAAGCTAGCTTAAGTAACGCCATTTTGCAAGGCATGGAAAAATACATAACTGA
GAATAGAGAAGTTCAGATCAAGGTCAGGAACAGATGGAACAGCTGAATATGGGCCAAACAGGATATCTGTGGTAAGCAGT
TCCTGCCCCGGCTCAGGGCCAAGAACAGATGGAACAGCTGAATATGGGCCAAACAGGATATCTGTGGTAAGCAGTTCCTG
CCCCGGCTCAGGGCCAAGAACAGATGGTCCCCAGATGCGGTCCAGCCCTCAGCAGTTTCTAGAGAACCATCAGATGTTTC
CAGGGTGCCCCAAGGACCTGAAATGACCCTGTGCCTTATTTGAACTAACCAATCAGTTCGCTTCTCGCTTCTGTTCGCGC
GCTTCTGCTCCCCGAGCTCAATAAAAGAGCCCACAACCCCTCACTCGGGGCGCCAGTCCTCCGATTGACTGAGTCGCCCG
GGTACCCGTGTATCCAATAAACCCTCTTGCAGTTGCATCCGACTTGTGGTCTCGCTGTTCCTTGGGAGGGTCTCCTCTGA
GTGATTGACTACCCGTCAGCGGGGGTCTTTCATT
5MoMuLV_LTR Regulatory
TTTGAAAGACCCCACCCGTAGGTGGCAAGCTAGCTTAAGTAACGCCACTTTGCAAGGCATGGAAAAATACATAACTGAGA
ATAGAAAAGTTCAGATCAAGGTCAGGAACAAAGAAACAGCTGAATACCAAACAGGATATCTGTGGTAAGCGGTTCCTGCC
CCGGCTCAGGGCCAAGAACAGATGAGACAGCTGAGTGATGGGCCAAACAGGATATCTGTGGTAAGCAGTTCCTGCCCCGG
CTCGGGGCCAAGAACAGATGGTCCCCAGATGCGGTCCAGCCCTCAGCAGTTTCTAGTGAATCATCAGATGTTTCCAGGGT
GCCCCAAGGACCTGAAAATGACCCTGTACCTTATTTGAACTAACCAATCAGTTCGCTTCTCGCTTCTGTTCGCGCGCTTC
CGCTCTCCGAGCTCAATAAAAGAGCCCACAACCCCTCACTCGGCGCGCCAGTCTTCCGATAGACTGCGTCGCCCGGGTAC
CCGTATTCCCAATAAAGCCTCTTGCTGTTTGCATCCGAATCGTGGTCTCGCTGTTCCTTGGGAGGGTCTCCTCTGAGTGA
TTGACTACCCACGACGGGGGTCTTTCATT
araO1 Regulatory
CGGCAGAAAAGT
araO2 Regulatory
AAACCAATTGTCCATA
CAG_enhancer Regulatory
CCTGCAGGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAAT
GACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACT
TGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTAT
GCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTAaCATGg
cI857_LR Regulatory
ATGAGCACAAAAAAGAAACCATTAACACAAGAGCAGCTTGAGGACGCACGTCGCCTTAAAGCAATTTATGAAAAAAAGAA
AAATGAACTTGGCTTATCCCAGGAATCTGTCGCAGACAAGATGGGGATGGGGCAGTCAGGCGTTGGTGCTTTATTTAATG
GCATCAATGCATTAAATGCTTATAACGCCGCATTGCTTACAAAAATTCTCAAAGTTAGCGTTGAAGAATTTAGCCCTTCA
ATCGCCAGAGAAATCTACGAGATGTATGAAGCGGTTAGTATGCAGCCGTCACTTAGAAGTGAGTATGAGTACCCTGTTTT
TTCTCATGTTCAGGCAGGGATGTTCTCACCTAAGCTTAGAACCTTTACCAAAGGTGATGCGGAGAGATGGGTAAGCACAA
CCAAAAAAGCCAGTGATTCTGCATTCTGGCTTGAGGTTGAAGGTAATTCCATGACCGCACCAACAGGCTCCAAGCCAAGC
TTTCCTGACGGAATGTTAATTCTCGTTGACCCTGAGCAGGCTGTTGAGCCAGGTGATTTCTGCATAGCCAGACTTGGGGG
TGATGAGTTTACCTTCAAGAAACTGATCAGGGATAGCGGTCAGGTGTTTTTACAACCACTAAACCCACAGTACCCAATGA
TCCCATGCAATGAGAGTTGTTCCGTTGTGGGGAAAGTTATCGCTAGTCAGTGGCCTGAAGAGACGTTTGGCTGA
GK Regulatory
ATGAGTCTGAAAGAAAAAACACAATCTCTGTTTGCCAACGCATTTGGCTACCCTGCCACTCACACCATTCAGGCGCCTGG
CCGCGTGAATTTGATTGGTGAACACACCGACTACAACGACGGTTTCGTTCTGCCCTGCGCGATTGATTATCAAACCGTGA
TCAGTTGTGCACCACGCGATGACCGTAAAGTTCGCGTGATGGCAGCCGATTATGAAAATCAGCTCGACGAGTTTTCCCTC
GATGCGCCCATTGTCGCACATGAAAACTATCAATGGGCTAACTACGTTCGTGGCGTGGTGAAACATCTGCAACTGCGTAA
CAACAGCTTCGGCGGCGTGGACATGGTTGATCACGGCAATGTGCCGCAGGGTGCCGGGTTAAGTTCTTCCGCTTCACTGG
AAGTCGCGGTCGGAACCGTATTGCAGCAGCTTTATCATCTGCCGCTGGACGGCGCACAAATCGCGCTTAACGGTCAGGAA
GCAGAAAACCAGTTTGTAGGCTGTAACTGCGGGATCATGGATCAGCTAATTTCCGCGCTCGGCAAGAAAGATCATGCCTT
GCTGATCGATTGCCGCTCACTGGGGACCAAAGCAGTTTCCATGCCCAAAGGTGTGGCTGTCGTCATCATCAACAGTAACT
TCAAACGTACCCTGGTTGGCAGCGAATACAACACCCGTCGTGAACAGTGCGAAACCGGTGCGCGTTTCTTCCAGCAGCCA
GCCCTGCGTGATGTCACCATTGAAGAGTTCAACGCTGTTGCGCATGAACTGGACCCGATCGTGGCAAAACGCGTGCGTCA
TATACTGACTGAAAACGCCCGCACCGTTGAAGCTGCCAGCGCGCTGGAGCAAGGCGACCTGAAACGTATGGGCGAGTTGA
TGGCGGAGTCTCATGCCTCTATGCGCGATGATTTCGAAATCACCGTGCCGCAAATTGACACTCTGGTAGAAATCGTCAAA
GCTGTGATTGGCGACAAAGGTGGCGTACGCATGACCGGCGGCGGATTTGGCGGCTGTATCGTCGCGCTGATCCCGGAAGA
GCTGGTGCCTGCCGTACAGCAACGTGTCGCTGAACAATATGAAGCAAAAACAGGTATTAAAGAGACTTTTTACGTTTGTA
AACCATCACAAGGAGCAGGACAGTGCTGA
IRES Regulatory
GCCCCTCTCCCTCCCCCCCCCCTAACGTTACTGGCCGAAGCCGCTTGGAATAAGGCCGGTGTGCGTTTGTCTATATGTTA
TTTTCCACCATATTGCCGTCTTTTGGCAATGTGAGGGCCCGGAAACCTGGCCCTGTCTTCTTGACGAGCATTCCTAGGGG
TCTTTCCCCTCTCGCCAAAGGAATGCAAGGTCTGTTGAATGTCGTGAAGGAAGCAGTTCCTCTGGAAGCTTCTTGAAGAC
AAACAACGTCTGTAGCGACCCTTTGCAGGCAGCGGAACCCCCCACCTGGCGACAGGTGCCTCTGCGGCCAAAAGCCACGT
GTATAAGATACACCTGCAAAGGCGGCACAACCCCAGTGCCACGTTGTGAGTTGGATAGTTGTGGAAAGAGTCAAATGGCT
CTCCTCAAGCGTATTCAACAAGGGGCTGAAGGATGCCCAGAAGGTACCCCATTGTATGGGATCTGATCTGGGGCCTCGGT
GCACATGCTTTACATGTGTTTAGTCGAGGTTAAAAAAACGTCTAGGCCCCCCGAACCACGGGGACGTGGTTTTCCTTTGA
AAAACACGATGATAATATGGCCACA
lacI Regulatory
GTGGTGAATGTGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGT
GAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAGCTGAATTACATTCCCAACC
GCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCG
CAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGT
CGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACC
AGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCCATCAAC
AGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTGGTCGCATTGGGTCACCAGCAAATCGCGCT
GTTAGCGGGCCCATTAAGTTCTGTCTCGGCGCGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCAATCAAATTC
AGCCGATAGCGGAACGGGAAGGCGACTGGAGTGCCATGTCCGGTTTTCAACAAACCATGCAAATGCTGAATGAGGGCATC
GTTCCCACTGCGATGCTGGTTGCCAACGATCAGATGGCGCTGGGCGCAATGCGCGCCATTACCGAGTCCGGGCTGCGCGT
TGGTGCGGATATCTCGGTAGTGGGATACGACGATACCGAAGACAGCTCATGTTATATCCCGCCGTTAACCACCATCAAAC
AGGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACCGCTTGCTGCAACTCTCTCAGGGCCAGGCGGTGAAGGGCAATCAG
CTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGA
TTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGA
lacO Regulatory
GGGAATTGTGAGCGGATAACAATTCCCC
RRE Regulatory
AGGAGCTTTGTTCCTTGGGTTCTTGGGAGCAGCAGGAAGCACTATGGGCGCAGCGTCAATGACGCTGACGGTACAGGCCA
GACAATTATTGTCTGGTATAGTGCAGCAGCAGAACAATTTGCTGAGGGCTATTGAGGCGCAACAGCATCTGTTGCAACTC
ACAGTCTGGGGCATCAAGCAGCTCCAGGCAAGAATCCTGGCTGTGGAAAGATACCTAAAGGATCAACAGCTCCT
rrnB_ATS Regulatory
CGCCGCTGAGAAAAAGCGAAGCGGCACTGCTCTTTAACAATTTATCAGACAATCTGTGTGGGCACTCGAC
SV40_enhancer Regulatory
GATCTGAACCATGGAGCGGAGAATGGGCGGAACTGGGCGGAGTTAGGGGCGGGATGGGCGGAGTTAGGGGCGGGACTATG
GTTGCTGACTAATTGAGATGCATGCTTTGCATACTTCTGCCTGCTGGGGAGCCTGGGGACTTTCCACACCTGGTTGCTGA
CTAATTGAGATGCATGCTTTGCATACTTCTGCCTGCTGGGGAGCCTGGGGACTTTCCACACCCTAACTGACACACATTCC
ACAGCA
TB Regulatory
AATAAAATATCTTTATTTTCATTACATCTGTGTGTTGGTTTTTTGTGTGAATCGATAGTACTAACATACGCTCTCCATCA
AAACAAAACGAAACAAAACAAACTAGCAAAATAGGCTGTCCCCAGTGCAAGTGCAGGTGCCAGAACATTTCTCT
tetO Regulatory
TCCCTATCAGTGATAGAGATCTCCCTATCAGTGATAGAGA
TetR Regulatory
TCTAGATTAGATAAAAGTAAAGTGATTAACAGCGCATTAGAGCTGCTTAATGAGGTCGGAATCGAAGGTTTAACAACCCG
TAAACTCGCCCAGAAGCTAGGTGTAGAGCAGCCTACATTGTATTGGCATGTAAAAAATAAGCGGGCTTTGCTCGACGCCT
TAGCCATTGAGATGTTAGATAGGCACCATACTCACTTTTGCCCTTTAGAAGGGGAAAGCTGGCAAGATTTTTTACGTAAT
AACGCTAAAAGTTTTAGATGTGCTTTACTAAGTCATCGCGATGGAGCAAAAGTACATTTAGGTACACGGCCTACAGAAAA
ACAGTATGAAACTCTCGAAAATCAATTAGCCTTTTTATGCCAACAAGGTTTTTCACTAGAGAATGCATTATATGCACTCA
GCGCTGTGGGGCATTTTACTTTAGGTTGCGTATTGGAAGATCAAGAGCATCAAGTCGCTAAAGAAGAAAGGGAAACACCT
ACTACTGATAGTATGCCGCCATTATTACGACAAGCTATCGAATTATTTGATCACCAAGGTGCAGAGCCAGCCTTCTTATT
CGGCCTTGAATTGATCATATGCGGATTAGAAAAACAACTTAAATGTGAAAGTGGGTCCGGACTCAGATCCA
Tn3R Regulatory
CTCAAAGATGCAGGGGTAAAAGCTAACCGCATCTTTACCGACAAGGCATCCGGCAGTTCAACAGATCGGGAAGGGCTGGA
TTTGCTGAGGATGAAGGTGGAGGAAGGTGATGTCATTCTGGTGAAGAAGCTCGACCGTCTTGGCCGCGACACCGCCGACA
TGATCCAACTGATAAAAGAGTTTGATGCTCAGGGTGTAGCGGTTCGGTTTATTGACGACGGGATCAGTACCGACGGTGAT
ATGGGGCAAATGGTGGTCACCATCCTGTCGGCTGTGGCACAGGCTGAACGCCGGAGGATCCTAGAGCGCACGAATGAGGG
CCGACAGGAAGCAAAGCTGAAAGGAATCAAATTTGGCCGCAGGCGTACCGTGGACAGGAACGTCGTGCTGACGCTTCATC
AGAAGGGCACTGGTGCAACGGAAATTGCTCATCAGCTCAGTATTGCCCGCTCCACGGTTTATAAAATTCTTGAAGACGAA
AGGGCCTCGTG
TRE Regulatory
CTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGT
GAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAA
AAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAG
AGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGCTCGGTACCCGGGTCGAG
TRE Regulatory
GTAAGGTCACAGGAGGTCACTCGCGTAAGGTCACAGGAGGTCACTCGC
bGH_PA_terminator Terminator
CGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCC
ACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGG
GCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTGGGGATGCGGTGGGCTCTATGG
CYC1_terminator Terminator
CACGTCCGACGGCGGCCCACGGGTCCCAGGCCTCGGAGATCCGTCCCCCTTTTCCTTTGTCGATATCATGTAATTAGTTA
TGTCACGCTTACATTCACGCCCTCCCCCCACATCCGCTCTAACCGAAAAGGAAGGAGTTAGACAACCTGAAGTCTAGGTC
CCTATTTATTTTTTTATAGTTATGTTAGTATTAAGAACGTTATTTATATTTCAAATTTTTCTTTTTTTTCTGTACAGACG
CGTGTACGCATGTAACATTATACTGAAAACCTTGCTTGAGAAGGTTTTGGGACGCTCGAAGGCTTTAATTTGCAAGCT
fd_terminator Terminator
ATACAATTAAAGGCTCCTTTTGGAGCCTTTTTTTTTGGAGATTTTCAACGT
fd_terminator Terminator
TAAACCGATACAATTAAAGGCTCCTTTTGGAGCCTTTTTTTTTGGAG
hGH_PA_terminator Terminator
ACGGGTGGCATCCCTGTGACCCCTCCCCAGTGCCTCTCCTGGCCCTGGAAGTTGCCACTCCAGTGCCCACCAGCCTTGTC
CTAATAAAATTAAGTTGCATCATTTTGTCTGACTAGGTGTCCTTCTATAATATTATGGGGTGGAGGGGGGTGGTATGGAG
CAAGGGGCAAGTTGGGAAGACAACCTGTAGGGCCTGCGGGGTCTATTGGGAACCAAGCTGGAGTGCAGTGGCACAATCTT
GGCTCACTGCAATCTCCGCCTCCTGGGTTCAAGCGATTCTCCTGCCTCAGCCTCCCGAGTTGTTGGGATTCCAGGCATGC
ATGACCAGGCTCAGCTAATTTTTGTTTTTTTGGTAGAGACGGGGTTTCACCATATTGGCCAGGCTGGTCTCCAACTCCTA
ATCTCAGGTGATCTACCCACCTTGGCCTCCCAAATTGCTGGGATTACAGGCGTGAACCACTGCTCCCTTCCCTGTCCTT
HIS3_3UTR_terminator Terminator
TGACACCGATTATTTAAAGCTGCAGCATACGATATATATACATGTGTATATATGTATACCTATGAATGTCAGTAAGTATG
TATACGAACAGTATGATACTGAAGATGACAAGGTAATGCATCATTCTATACGTGTCATTCTGAACGAGGCGCGCTTTCCT
TTTTTCTTTTTGCTTTTTCTTTTTTTTTCTCTTGAACTCGAGAAAAAAAATATAAAAGAGATGGAGGAACGGGAAAAAGT
TAGTTGTGGTGATAGGTGGCAAGTGGTATTCCGTAAGAACAACAAGAAAAGCATTTCATATTATGGCTGAACTGAGCGAA
CAAGTGCAAAATTTAAGCATCAACGACAACAACGAGAATGGTTATGTTCCTCCTCACTTAAGAGGAAAACCAAGAAGTGC
CAGAAATAACATGAGCAACTACAATAACAACAACGGCGGCTACAACGGTGGCCGTGGCGGTGGCAGCTTCTTTAGCAACA
ACCGTCGTGGTGGTTACGGCAACGGTGGTTTCTTCGGTGGAAACAACGGTGGCAGCAGATCTAACGGCCGTTCTGGTGGT
AGATGGATCGATGGCAAACATGTCCCAGCTCCAAGAAACGAAAAGGCCGAGATCGCCATATTTGGTGTCCCCGAG
rb_glob_PA_terminator Terminator
TTCACTCCTCAGGTGCAGGCTGCCTATCAGAAGGTGGTGGCTGGTGTGGCCAATGCCCTGGCTCACAAATACCACTGAGA
TCTTTTTCCCTCTGCCAAAAATTATGGGGACATCATGAAGCCCCTTGAGCATCTGACTTCTGGCTAATAAAGGAAATTTA
TTTTCATTGCAATAGTGTGTTGGAATTTTTTGTGTCTCTCACTCGGAAGGACATATGGGAGGGCAAATCATTTAAAACAT
CAGAATGAGTATTTGGTTTAGAGTTTGGCAACATATGCCCATATGCTGGCTGCCATGAACAAAGGTTGGCTATAAAGAGG
TCATCAGTATATGAAACAGCCCCCTGCTGTCCATTCCTTATTCCATAGAAAAGCCTTGACTTGAGGTTAGATTTTTTTTA
TATTTTGTTTTGTGTTATTTTTTTCTTTAACATCCCTAAAATTTTCCTTACATGTTTTACTAGCCAGATTTTTCCTCCTC
TCCTGACTACTCCCAGTCATAGCTGTCCCTCTTCTCTTATGGAGATC
rrnB_T1_terminator Terminator
ATAAAACGAAAGGCTCAGTCGGAAGACTGGGCCTTTCGTTTTAT
rrnB_T2_terminator Terminator
AGAAGGCCATCCTGACGGATGGCCTTTT
rrnB_terminator Terminator
TGCCTGGCGGCAGTAGCGCGGTGGTCCCACCTGACCCCATGCCGAACTCAGAAGTGAAACGCCGTAGCGCCGATGGTAGT
GTGGGGTCTCCCCATGCGAGAGTAGGGAACTGCCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTT
SV40_PA_terminator Terminator
CCATGGCCCAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATT
TTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTGGATCTC
SV40_PA_terminator Terminator
TGATCATAATCAAGCCATATCACATCTGTAGAGGTTTACTTGCTTTAAAAAACCTCCACACCTCCCCCTGAACCTGAAAC
ATAAAATGAATGCAATTGTTGTTGTTAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAAT
TTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTGGAT
CTGC
synth_PA_terminator Terminator
AATAAAATATCTTTATTTTCATTACATCTGTGTGTTGGTTTTTTGTGTG
T4_32_terminator Terminator
TTGGGGACCCTAGAGGTCCCCTTTTTTATTTT
T7_terminator Terminator
ATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTGA
T7_terminator Terminator
CTGCTAACAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAACCCCTTGGGGCCTCT
AAACGGGTCTTGAGGGGTTTTTTGCTGAAAGGAGGAACTATATCCGGAT
TK_PA_terminator Terminator
GGGGGAGGCTAACTGAAACACGGAAGGAGACAATACCGGAAGGAACCCGCGCTATGACGGCAATAAAAAGACAGAATAAA
ACGCACGGGTGTTGGGTCGTTTGTTCATAAACGCGGGGTTCGGTCCCAGGGCTGGCACTCTGTCGATACCCCACCGAGAC
CCCATTGGGGCCAATACGCCCGCGTTTCTTCCTTTTCCCCACCCCACCCCCCAAGTTCGGGTGAAGGCCCAGGGCTCGCA
GCCAACGTCGGGGCGGCAGGCCCTGCCATAG
trpA_terminator Terminator
AGCCCGCCTAATGAGCGGGCTTTTTTTT
up_PA_terminator Terminator
AATAAAATATCTTTATTTTCATTACATCTGTGTGTTGGTTTTTTGTGTGAATCGATAGTACTAACATACGCTCTCCATCA
AAACAAAACGAAACAAAACAAACTAGCAAAATAGGCTGTCCCCAGTGCAAGTGCAGGTGCCAGAACATTTCTCT
ura4_terminator Terminator
TTCTGTAAAATTTTTTTGGTTGGTTATTGAAAAAGTCGATGCCTTGTTTGCGTTTGTTTTCCTAGGCGTTTTATGTCAGA
AGGCATTTAGAATTAGTATACAAGTACTCTTTGGTAAAATTTTATGTAGCGACTAAAATATTAACTATTATAGATAAACA
CCTTGGGAATAAAAAGTAATTTGCTATAGTAATTTATTAAACATGCTCCTACAACATTACCACAATCTTTTCTCTTGGAT
TGACATTGAATAAGAAAAGAGTGAATTTTTTTAGACTTGTAATGATAACTATGTACAAAGCCAATGAAAGATGTATGTAG
ATGAATGTAAAATACCATGTAGACAAACAAGATAAAACTTGGTTATAAACATTGGTGTTGGAACAGAATAAATTAGATGT
CAAAAAGTTTCGTCAATATCACAAGCT
yADH1_terminator Terminator
GCGAATTTCTTATGATTTATGATTTTTATTATTAAATAAGTTATAAAAAAAATAAGTGTATACAAATTTTAAAGTGACTC
TTAGGTTTTAAAACGAAAATTCTTGTTCTTGAGTAACTCTTTCCTGTAGGTCAGGTTGCTTTCTCAGGTATAGCATGAGG
TCGCTCTTATTGACCACACCTCTACCGGCATG
yADH2_terminator Terminator
AAGCTTTGGACTTCTTCGCCAGAGGTTTGGTCAAGTCTCCAATCAAGGTTGTCGGCTTGTCTACCTTGCCAGAAATTTAC
GAAAAGATGGAAAAGGGTCAAATCGTTGGTAGATACGTTGTTGACACTTCTAAATAAGCGAATTTCTTATGATTTATGAT
TTTTATTATTAAATAAGTTATAAAAAAAATAAGTGTATACAAATTTTAAAGTGACTCTTAGGTTTTAAAACGAAAATTCT
TATTCTTGAGTAACTCTTTCCTGTAGGTCAGGTTGCTTTCTCAGGTATAGCATGAGGTCGCTCTTATTGACCACACCTCT
ACCGGCC