-
PurposeSox2 promoter reporter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 101761 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepGL3
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 4818
- Total vector size (bp) 5878
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSRY-box 2 promoter
-
Alt nameSOX2 promoter
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1060
-
Entrez GeneSOX2 (a.k.a. ANOP3, MCOPS3)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Kpn1 (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer RVprimer3
- 3′ sequencing primer CTAGCAAAATAGGCTGTCCC (Common Sequencing Primers)
Resource Information
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
-
Article Citing this Plasmid
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGL3-Sox2 was a gift from Yuh-Shan Jou (Addgene plasmid # 101761 ; http://n2t.net/addgene:101761 ; RRID:Addgene_101761) -
For your References section:
PSPC1 mediates TGF-beta1 autocrine signalling and Smad2/3 target switching to promote EMT, stemness and metastasis. Yeh HW, Hsu EC, Lee SS, Lang YD, Lin YC, Chang CY, Lee SY, Gu DL, Shih JH, Ho CM, Chen CF, Chen CT, Tu PH, Cheng CF, Chen RH, Yang RB, Jou YS. Nat Cell Biol. 2018 Apr;20(4):479-491. doi: 10.1038/s41556-018-0062-y. Epub 2018 Mar 28. 10.1038/s41556-018-0062-y PubMed 29593326