Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pGL3-Sox2
(Plasmid #101761)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 101761 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pGL3
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 4818
  • Total vector size (bp) 5878
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SRY-box 2 promoter
  • Alt name
    SOX2 promoter
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1060
  • Entrez Gene
    SOX2 (a.k.a. ANOP3, MCOPS3)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Kpn1 (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer RVprimer3
  • 3′ sequencing primer CTAGCAAAATAGGCTGTCCC
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGL3-Sox2 was a gift from Yuh-Shan Jou (Addgene plasmid # 101761 ; http://n2t.net/addgene:101761 ; RRID:Addgene_101761)
  • For your References section:

    PSPC1 mediates TGF-beta1 autocrine signalling and Smad2/3 target switching to promote EMT, stemness and metastasis. Yeh HW, Hsu EC, Lee SS, Lang YD, Lin YC, Chang CY, Lee SY, Gu DL, Shih JH, Ho CM, Chen CF, Chen CT, Tu PH, Cheng CF, Chen RH, Yang RB, Jou YS. Nat Cell Biol. 2018 Apr;20(4):479-491. doi: 10.1038/s41556-018-0062-y. Epub 2018 Mar 28. 10.1038/s41556-018-0062-y PubMed 29593326