pVC-Ds-E1b:eGFP-Ds
(Plasmid #102417)

• Purpose: Fluorescent vector for screening enhancer elements in zebrafish
• Depositing Lab: Tatjana Sauka-Spengler
• Publication: Chong-Morrison et al bioRxiv

Ordering

Item	Catalog #	Description	Quantity	Price (USD)
Plasmid	102417	Standard format: Plasmid sent in bacteria as agar stab	1	$75	Add to Cart

This material is available to academics and nonprofits only.

Backbone

• Vector backbone: Unknown
  (Search Vector Database)
• Backbone size w/o insert (bp): 3873
• Total vector size (bp): 5338
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: E1b:eGFP
• Species: D. rerio (zebrafish)
• Insert Size (bp): 1465
• Promoter: Zebrafish E1b minimal promoter

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ATCCCGTACCGACCGTTATC
• 3′ sequencing primer: GGTAATGGTAGCGACCGGC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Plasmid #37846 (N. Ahituv) and parts of plasmid obtained directly from the authors listed, via MTA dated 27th August 2012.
• Terms and Licenses:
  • UBMTA
  • Ancillary Agreement for Plasmids Containing FP Materials
• Industry Terms:
  • Not Available to Industry
• Article Citing this Plasmid:
  • 1 Reference

Depositor Comments

A. Emelyanov and S. Parinov. Mifepristone-inducible LexPR system to drive and control gene expression in transgenic zebrafish. Developmental Biology, 320(1):113– 121, 2008. ISSN 00121606. doi: 10.1016/j.ydbio.2008.04.042.

A. Emelyanov, Y. Gao, N. I. Naqvi, and S. Parinov. Trans-kingdom transposition of the maize Dissociation element. Genetics, 174(3):1095–1104, 2006. ISSN 00166731. doi: 10.1534/genetics.106.061184.