pVC-Ds-E1b:eGFP-Ds
(Plasmid
#102417)
-
PurposeFluorescent vector for screening enhancer elements in zebrafish
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 102417 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneUnknown
- Backbone size w/o insert (bp) 3873
- Total vector size (bp) 5338
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameE1b:eGFP
-
SpeciesD. rerio (zebrafish)
-
Insert Size (bp)1465
- Promoter Zebrafish E1b minimal promoter
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ATCCCGTACCGACCGTTATC
- 3′ sequencing primer GGTAATGGTAGCGACCGGC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byPlasmid #37846 (N. Ahituv) and parts of plasmid obtained directly from the authors listed, via MTA dated 27th August 2012.
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
-
Article Citing this Plasmid
Depositor Comments
A. Emelyanov and S. Parinov. Mifepristone-inducible LexPR system to drive and control gene expression in transgenic zebrafish. Developmental Biology, 320(1):113– 121, 2008. ISSN 00121606. doi: 10.1016/j.ydbio.2008.04.042.
A. Emelyanov, Y. Gao, N. I. Naqvi, and S. Parinov. Trans-kingdom transposition of the maize Dissociation element. Genetics, 174(3):1095–1104, 2006. ISSN 00166731. doi: 10.1534/genetics.106.061184.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pVC-Ds-E1b:eGFP-Ds was a gift from Tatjana Sauka-Spengler (Addgene plasmid # 102417 ; http://n2t.net/addgene:102417 ; RRID:Addgene_102417) -
For your References section:
Re-purposing Ac/Ds transgenic system for CRISPR/dCas9 modulation of enhancers and non-coding RNAs in zebrafish. Chong-Morrison V, Simões FC, Senanayake U, Carroll DS, Riley PR, Sauka-Spengler T. bioRxiv 10.1101/450684