Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pVC-Ds-E1b:eGFP-Ds
(Plasmid #102417)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 102417 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    Unknown
  • Backbone size w/o insert (bp) 3873
  • Total vector size (bp) 5338
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    E1b:eGFP
  • Species
    D. rerio (zebrafish)
  • Insert Size (bp)
    1465
  • Promoter Zebrafish E1b minimal promoter

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ATCCCGTACCGACCGTTATC
  • 3′ sequencing primer GGTAATGGTAGCGACCGGC
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

A. Emelyanov and S. Parinov. Mifepristone-inducible LexPR system to drive and control gene expression in transgenic zebrafish. Developmental Biology, 320(1):113– 121, 2008. ISSN 00121606. doi: 10.1016/j.ydbio.2008.04.042.

A. Emelyanov, Y. Gao, N. I. Naqvi, and S. Parinov. Trans-kingdom transposition of the maize Dissociation element. Genetics, 174(3):1095–1104, 2006. ISSN 00166731. doi: 10.1534/genetics.106.061184.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pVC-Ds-E1b:eGFP-Ds was a gift from Tatjana Sauka-Spengler (Addgene plasmid # 102417 ; http://n2t.net/addgene:102417 ; RRID:Addgene_102417)
  • For your References section:

    Re-purposing Ac/Ds transgenic system for CRISPR/dCas9 modulation of enhancers and non-coding RNAs in zebrafish. Chong-Morrison V, Simões FC, Senanayake U, Carroll DS, Riley PR, Sauka-Spengler T. bioRxiv 10.1101/450684