Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

myc-hIFITM3-delta1-21
(Plasmid #104365)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104365 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCMV-myc
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 3800
  • Total vector size (bp) 4139
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    IFITM3
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    339
  • Mutation
    deleted amino acids 1-21
  • Entrez Gene
    IFITM3 (a.k.a. 1-8U, DSPA2b, IP15)
  • Promoter CMV
  • Tag / Fusion Protein
    • myc (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoR1 (not destroyed)
  • 3′ cloning site Sal (not destroyed)
  • 5′ sequencing primer GATCCGGTACTAGAGGAACTGAAAAAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    myc-hIFITM3-delta1-21 was a gift from Jacob Yount (Addgene plasmid # 104365 ; http://n2t.net/addgene:104365 ; RRID:Addgene_104365)
  • For your References section:

    E3 Ubiquitin Ligase NEDD4 Promotes Influenza Virus Infection by Decreasing Levels of the Antiviral Protein IFITM3. Chesarino NM, McMichael TM, Yount JS. PLoS Pathog. 2015 Aug 11;11(8):e1005095. doi: 10.1371/journal.ppat.1005095. eCollection 2015 Aug. 10.1371/journal.ppat.1005095 PubMed 26263374