Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pGP-AAV-syn-FLEX-jGCaMP7b-WPRE
(Plasmid #104493)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104493 Standard format: Plasmid sent in bacteria as agar stab 1 $65
AAV1 104493-AAV1 Virus (100 µL at titer ≥ 1×10¹³ vg/mL) and Plasmid. More Information
$380

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    AAV-Syn-FLEX
  • Backbone manufacturer
    Scott Sternson
  • Backbone size w/o insert (bp) 4894
  • Total vector size (bp) 6247
  • Vector type
    Mammalian Expression, AAV, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    jGCaMP7b
  • Alt name
    GCaMP3-T302P R303P A317L M374Y D380Y T381R S383T R392G
  • Alt name
    GCaMP3 variant 1561
  • Alt name
    Janelia GCaMP7
  • Species
    R. norvegicus (rat), G. gallus (chicken); A. victoria (jellyfish)
  • Insert Size (bp)
    1353
  • Promoter Synapsin
  • Tag / Fusion Protein
    • T7 epitope, Xpress tag, 6xHis

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer ACCACGCGAGGCGCGAGATAG
  • (Common Sequencing Primers)

Resource Information

Information for AAV1 (Catalog # 104493-AAV1) ( Back to top )

Purpose

Ready-to-use AAV1 particles produced from pGP-AAV-syn-FLEX-jGCaMP7b-WPRE (#104493). In addition to the viral particles, you will also receive purified pGP-AAV-syn-FLEX-jGCaMP7b-WPRE plasmid DNA.

Synapsin-driven, Cre-dependent jGCaMP7b expression. jGCaMP7b exhibits the brightest resting fluorescence and can be used for imaging of small neuronal processes (dendrites and axons). These AAV preparations are suitable purity for injection into animals.

Delivery

  • Volume 100 µL
  • Titer ≥ 1×10¹³ vg/mL
  • Pricing $350 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV1 cap gene
  • Buffer PBS + 0.001% Pluronic F-68
  • Serotype AAV1
  • Purification Iodixanol gradient ultracentrifugation

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Addgene Comments

Using FLEX vectors in vivo: LoxP sites in FLEX plasmids are known to recombine during DNA amplification and viral vector production, which may result in a minority of Cre-activated (i.e., "flipped") viral vectors. Addgene has measured this occurs in 0.01-0.03% of viral vectors in our typical production protocol. This can lead to a small number of cells exhibiting Cre-independent transgene expression in vivo. To address this, we recommend titrating to find the optimal AAV dosage required for Cre-dependent transgene expression and function in vivo. This may include reducing the viral vector dosage in order to reduce the likelihood of Cre-independent expression.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGP-AAV-syn-FLEX-jGCaMP7b-WPRE was a gift from Douglas Kim & GENIE Project (Addgene plasmid # 104493 ; http://n2t.net/addgene:104493 ; RRID:Addgene_104493)

    For viral preps, please replace (Addgene plasmid # 104493) in the above sentence with: (Addgene viral prep # 104493-AAV1)

  • For your References section:

    High-performance GFP-based calcium indicators for imaging activity in neuronal populations and microcompartments. Dana H, Sun Y, Mohar B, Hulse B, Hasseman JP, Tsegaye G, Tsang A, Wong A, Patel R, Macklin JJ, Chen Y, Konnerth A, Jayaraman V, Looger LL, Schreiter ER, Svoboda K, Kim DS.. bioRxiv 434589 10.1101/434589