pX601-miniCMV-SaCas9-U6-YFPvsSaCas9 sgRNA
(Plasmid
#107050)
-
PurposeAll-in-one vectors expressing both SaCas9 and YFP sgRNA
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 107050 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV
-
Vector typeMammalian Expression, AAV, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSaCas9
-
gRNA/shRNA sequenceGTACGTCGCCGTCCAGCTCGAC
-
SpeciesSynthetic
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
Resource Information
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
Depositor Comments
YFP sgRNA for SaCas9
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX601-miniCMV-SaCas9-U6-YFPvsSaCas9 sgRNA was a gift from Alex Hewitt (Addgene plasmid # 107050 ; http://n2t.net/addgene:107050 ; RRID:Addgene_107050)