Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLexA::lis-1
(Plasmid #11338)

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 11338 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLexA
  • Backbone manufacturer
    see pLexA map in "author's map"
  • Backbone size w/o insert (bp) 5700
  • Vector type
    Yeast Expression
  • Selectable markers
    TRP1

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    lis-1
  • Species
    C. elegans (nematode)
  • Insert Size (bp)
    1200
  • GenBank ID
    NM_067354
  • Entrez Gene
    lis-1
  • Tag / Fusion Protein
    • LexA DNA Binding Domain (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site PstI (not destroyed)
  • 5′ sequencing primer LexA sequencing primer (CGTCAGCAGAGCTTCACCATTG)
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Full-length cDNA for C. elegans open-reading frame T03F6.5, encoding the lis-1 gene, cloned into the yeast two-hybrid DNA-binding domain vector pLexA. This vector can be used as the bait for a yeast two-hybrid screen. See "author's map" for picture of empty pLexA vector.

This plasmid is intended for use exclusively as a teaching resource as part of the Integrated Genomics Discovery-Based Laboratory Course. Addgene does not make any guarantee that the plasmid is suitable for research purposes.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLexA::lis-1 was a gift from Guy Caldwell (Addgene plasmid # 11338 ; http://n2t.net/addgene:11338 ; RRID:Addgene_11338)