Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

3xHA-miniTurbo_pAS32
(Plasmid #118222)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 118222 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    Bluescript
  • Backbone size w/o insert (bp) 6954
  • Total vector size (bp) 7914
  • Modifications to backbone
    The backbone contains a gut promoter and unc-54 UTR for worm intestine expression of miniTurbo.
  • Vector type
    Worm Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    miniTurbo (BirA mutant)
  • Species
    C. elegans (nematode)
  • Insert Size (bp)
    873
  • Mutation
    aa1-63 deleted; Q65P, I87V, R118S, E140K, Q141R, S150G, L151P, V160A, T192A, K194I, M209V, I305V
  • Promoter ges-1p
  • Tag / Fusion Protein
    • 3x HA tag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site FseI (unknown if destroyed)
  • 3′ cloning site XmaI (unknown if destroyed)
  • 5′ sequencing primer aagaacgtgatcgcagctctac
  • 3′ sequencing primer cacaatttcattgttagaggtgactt
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    3xHA-miniTurbo_pAS32 was a gift from Jessica Feldman (Addgene plasmid # 118222 ; http://n2t.net/addgene:118222 ; RRID:Addgene_118222)
  • For your References section:

    Efficient proximity labeling in living cells and organisms with TurboID. Branon TC, Bosch JA, Sanchez AD, Udeshi ND, Svinkina T, Carr SA, Feldman JL, Perrimon N, Ting AY. Nat Biotechnol. 2018 Aug 20. pii: nbt.4201. doi: 10.1038/nbt.4201. 10.1038/nbt.4201 PubMed 30125270