Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #120922)


Item Catalog # Description Quantity Price (USD)
Plasmid 120922 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
    H. sapiens (human)
  • Promoter hCMV
  • Tag / Fusion Protein
    • none (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Xho I not unique (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer ACTACATCCTGGTCATCATCC
  • 3′ sequencing primer CCACCTTCTGATAGGCAGCC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    cloned from plasmid addgene #63798 SP-dCAS9-VPR
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry

Depositor Comments

Please visit for BioRxiv preprint. Please note the S1159N point mutation found in Cas9 is not of functional concern.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    BICstim-Gag-dCAS9-VPR was a gift from Philippe Mangeot & Théophile Ohlmann & Emiliano Ricci (Addgene plasmid # 120922 ; ; RRID:Addgene_120922)
  • For your References section:

    Genome editing in primary cells and in vivo using viral-derived Nanoblades loaded with Cas9-sgRNA ribonucleoproteins. Mangeot PE, Risson V, Fusil F, Marnef A, Laurent E, Blin J, Mournetas V, Massourides E, Sohier TJM, Corbin A, Aube F, Teixeira M, Pinset C, Schaeffer L, Legube G, Cosset FL, Verhoeyen E, Ohlmann T, Ricci EP. Nat Commun. 2019 Jan 3;10(1):45. doi: 10.1038/s41467-018-07845-z. 10.1038/s41467-018-07845-z PubMed 30604748