HA-Foxo1 (pCMV5)
(Plasmid #12142)

Loading...
Available to Academic and Nonprofits Only

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Sequence Information

Full plasmid sequence is available only if provided by the depositing laboratory.

Gene/Insert

  • Gene/Insert name
    Foxo1
  • Alt name
    Fkrh
  • Alt name
    forkhead box O1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2100
  • Mutation
    Wild-type
  • GenBank ID
    NM_019739
  • Entrez Gene
    Foxo1 (a.k.a. AI876417, Afxh, FKHR, Fkhr1, Foxo1a)
  • Promoter CMV
  • Tags / Fusion Proteins
    • Myc (N terminal on backbone)
    • HA (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer CMV-F; pCEP-F
  • 3′ sequencing primer hGH-pA-R (CCAGCTTGGTTCCCAATAGA)
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses

Depositor Comments

Plasmid contains K219R and L619P polymorphisms, which are not known to affect function.

How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    HA-Foxo1 (pCMV5) was a gift from Domenico Accili (Addgene plasmid # 12142)
  • For your References section:

    The forkhead transcription factor Foxo1 (Fkhr) confers insulin sensitivity onto glucose-6-phosphatase expression. Nakae J, Kitamura T, Silver DL, Accili D. J Clin Invest. 2001 Nov . 108(9):1359-67. 10.1172/JCI12876 PubMed 11696581