1
Plasmid 12142: HA-Foxo1 (pCMV5)
  • Foxo1

  • Fkrh

  • forkhead box O1

  • 2100

  • M. musculus (mouse)

  • NM_019739

  • Foxo1 (AI876417, Afxh, FKHR, Fkhr1, Foxo1a)

  • Myc

  • N terminal on backbone

  • HA

  • N terminal on insert

  • Wild-type

  • pCMV5
    (Search Vector Database)

  • Mammalian Expression

  • 4657

  • CMV

  • KpnI

  • No

  • XbaI

  • No

  • CMV-F; pCEP-F List of Sequencing Primers

  • hGH-pA-R (CCAGCTTGGTTCCCAATAGA)

  • Ampicillin

  • DH5alpha

  • 37

  • Unknown

  • View sequences (3)
  • Domenico Accili

  • MTA

Comments: 

Plasmid contains K219R and L619P polymorphisms, which are not known to affect function.

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: The forkhead transcription factor Foxo1 (Fkhr) confers insulin sensitivity onto glucose-6-phosphatase expression. Nakae et al (J Clin Invest. 2001 Nov . 108(9):1359-67. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 12142" in your Materials and Methods section.

Price: US $65

Available to academic and non-profits only