This website uses cookies to ensure you get the best experience. By continuing the use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

HA-Foxo1 (pCMV5)
(Plasmid #12142)


Item Catalog # Description Quantity Price (USD)
Plasmid 12142 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Alt name
  • Alt name
    forkhead box O1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
  • Mutation
  • GenBank ID
  • Entrez Gene
    Foxo1 (a.k.a. AI876417, Afxh, FKHR, Fkhr1, Foxo1a)
  • Promoter CMV
  • Tags / Fusion Proteins
    • Myc (N terminal on backbone)
    • HA (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer CMV-F; pCEP-F
  • 3′ sequencing primer hGH-pA-R (CCAGCTTGGTTCCCAATAGA)
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Plasmid contains K219R and L619P polymorphisms, which are not known to affect function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    HA-Foxo1 (pCMV5) was a gift from Domenico Accili (Addgene plasmid # 12142)
  • For your References section:

    The forkhead transcription factor Foxo1 (Fkhr) confers insulin sensitivity onto glucose-6-phosphatase expression. Nakae J, Kitamura T, Silver DL, Accili D. J Clin Invest. 2001 Nov . 108(9):1359-67. 10.1172/JCI12876 PubMed 11696581