Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCMV6M-Pak1 P191G, P192A
(Plasmid #12213)

Full plasmid sequence is not available for this item.

Loading...

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 12213 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCMV6
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 4900
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Pak1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2000
  • Mutation
    PIX (PAK-interacting exchange factor) binding mutant: P191G, P192A. NarI site added as a result of site-directed mutagenesis
  • Entrez Gene
    PAK1 (a.k.a. IDDMSSD, PAKalpha, alpha-PAK, p65-PAK)
  • Tag / Fusion Protein
    • Myc (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CTCGTTTAGTGAACCGTCAG
  • 3′ sequencing primer GGAACTTCCAAGGCCAGGA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Pak1 contains a G401S mutation. Depositor states that this mutation should not affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV6M-Pak1 P191G, P192A was a gift from Jonathan Chernoff (Addgene plasmid # 12213 ; http://n2t.net/addgene:12213 ; RRID:Addgene_12213)