Modified Shipping Schedule: Addgene will be closed November 23rd & 24th for the Thanksgiving holiday. Order processing and shipping may be delayed the week of Nov 20 - 24. If you have any questions, please contact us at [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pHR-CMV-nlsCRE
(Plasmid #12265)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 12265 Plasmid sent as bacteria in agar stab 1 $65
Lentiviral Prep 12265-LV Virus (1 mL at titer ≥ 1x10⁶ TU/mL)
and Plasmid. More Information
$250

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pHR-CRE
  • Backbone size w/o insert (bp) 9795
  • Vector type
    Mammalian Expression, Lentiviral, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Growth instructions
    Use Stbl3 or HB101 to reduce chance of recombination. Grow at 37C
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cre

Cloning Information

Resource Information

  • Terms and Licenses

Depositor Comments

Please note that the full sequence for this plasmid is approximated and not fully verified. Please visit the Trono lab http://tronolab.epfl.ch for cloning strategies, protocols, publications, and more. See LentiWeb http://www.lentiweb.com for discussion on cloning strategies and protocols.

Information for Lentiviral Prep (Catalog # 12265-LV) ( Back to top )

Purpose

Ready-to-use Lentiviral Prep particles produced from pHR-CMV-nlsCRE (#12265). In addition to the viral particles, you will also receive purified pHR-CMV-nlsCRE plasmid DNA.

Lentiviral particles carrying CRE recombinase.

Delivery

  • Volume 1 mL
  • Titer ≥1x10⁶ TU/mL
  • Pricing $220 USD for preparation of 1 mL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids psPAX2 (plasmid #12260)
  • Envelope pMD2.G (plasmid #12259)
  • Buffer DMEM +10% FBS

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Viral Quality Control

Titering Method:
  • Proviral Integration Assay: Lenti-X 293T cells were serially transduced with 12265-LV or a control virus of known titer. 72 hours after transduction cells were harvested, and gDNA extracted and assessed for integrated copies of WPRE.
Notes:
  • PCR confirmation of insert: PCR was carried out with primers targeting CRE and WPRE. The PCR product was visualized on an agarose gel for size confirmation.
    Forward Primer: CMV-F TTTACGGCGCTAAGGATGAC
    Reverse Primer: WPRE-R CATAGCGTAAAAGGAGCAACA
  • Confirmation of Cre activity: Expression of Cre following transduction with 12265-LV was confirmed using a Cre reporter assay.
  • Toxicity: Please note that that Cre expression is toxic in some cell lines due to cryptic loxP sites in the genome. If you are unsure how your cell line of interest tolerates Cre expression, consider transducing with a range MOIs or transducing an array of cell lines.

Visit our viral production page for more information.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHR-CMV-nlsCRE was a gift from Didier Trono (Addgene plasmid # 12265)
  • For your References section:

    Lentivector-mediated transfer of Bmi-1 and telomerase in muscle satellite cells yields a duchenne myoblast cell line with long-term genotypic and phenotypic stability. Cudre-Mauroux C, Occhiodoro T, Konig S, Salmon P, Bernheim L, Trono D. Hum Gene Ther. 2003 Nov 1. 14(16):1525-33. 10.1089/104303403322495034 PubMed 14577914