Skip to main content
Holiday Schedule: Addgene will be closed December 24 - December 31. Order processing and shipping will resume on January 3, 2022. For questions about estimated ship dates, please feel free to track your order status or contact [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #12555)


Item Catalog # Description Quantity Price (USD)
Plasmid 12555 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size (bp) 4750
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Tag / Fusion Protein
    • 3xHA (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Xba1, BamH1 (not destroyed)
  • 3′ cloning site EcoR1 (not destroyed)
  • 5′ sequencing primer CAGGTCCAACTGCACCTCGGTTC
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
  • Articles Citing this Plasmid

Depositor Comments

CMV promoter, SV40 ori; BamH1 site in same frame as pGEX-2T; XbaI cloning site is upstream of the triple HA tag, so can add the tag either 5' or 3' to your insert.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pKH3 was a gift from Ian Macara (Addgene plasmid # 12555 ; ; RRID:Addgene_12555)
  • For your References section:

    Phosphorylation-dependent activation of the Ras-GRF/CDC25Mm exchange factor by muscarinic receptors and G-protein beta gamma subunits. Mattingly RR, Macara IG. Nature. 1996 Jul 18. 382(6588):268-72. 10.1038/382268a0 PubMed 8717044