1
Plasmid Cart
Login to add to cart
Recently Visited
Plasmid 12610: pH3U3-Zif268
  • Zif268 binding site in pH3U3

  • 21

  • PH3U3-mcs
    (Search Vector Database)

  • Bacterial Expression

  • 5821

  • AscI

  • No

  • NotI

  • No

  • CAAATATGTATCCGCTCATGAC List of Sequencing Primers

  • Kanamycin

  • DH5alpha

  • 37

  • Low Copy

  • URA3, HIS3

  • View sequences (2)
  • Scot Wolfe

  • MTA

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: A bacterial one-hybrid system for determining the DNA-binding specificity of transcription factors. Meng et al (Nat Biotechnol. 2005 Aug . 23(8):988-94. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 12610" in your Materials and Methods section.