1
Plasmid 12613: pB1H2
  • dorsal RHR in pB1H2

  • dorsal

  • 887

  • D. melanogaster (fly)

  • CG6667

  • dl (Dmel_CG6667, CG6667, DL, Dl, Dmel\CG6667, GSd447, anon-EST:GressD7, d, dL, fs(2)k10816, mat(2)dorsal)

  • flag

  • N terminal on backbone

  • pB1H2
    (Search Vector Database)

  • Bacterial Expression

  • 4093

  • KpnI

  • No

  • AvrII

  • No

  • CGTGATGTACGTCAGCCTGAAG List of Sequencing Primers

  • TTGTCGGCCTTTTTCTAGTCTCTAGA

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • View sequences (2)
  • View map

  • Scot Wolfe

  • MTA

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: A bacterial one-hybrid system for determining the DNA-binding specificity of transcription factors. Meng et al (Nat Biotechnol. 2005 Aug . 23(8):988-94. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 12613" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only