Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pDmelOR
(Plasmid #126476)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 126476 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    DmelOrco
  • Alt name
    Orco
  • Alt name
    Odorant receptor co-receptor
  • Species
    D. melanogaster (fly)
  • Insert Size (bp)
    1509
  • Mutation
    codon optimization for H. sapiens; includes a recombinant β-globin/IgG chimeric intron to inhibit its functional expression in bacteria
  • Entrez Gene
    Orco (a.k.a. Dmel_CG10609, 83A.2, 83b, A45, CG10609, DOR45, DOR83b, DmORCO, DmOrco, DmelOrco, Dmel\CG10609, OR49, OR83B, OR83b, ORCO, Or83b, OrCo, or83b, orco, vainsA)
  • Promoter CMV
  • Tag / Fusion Protein
    • Myc (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer GTGTACGGTGGGAGGTCTATATAAG
  • 3′ sequencing primer GTGGTATGGCTGATTATGATCCTCT
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Is it recommended to digest the vector with XhoI and PvuI-HF and gel purify the two bands before sequencing as the two CMV promoters and SV40-polyA sequences are very similar to each other. Use the EcoRI restriction site for best functional expression on the MCS2. Please visit https://www.biorxiv.org/content/10.1101/669127v1 for BioRxiv preprint

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDmelOR was a gift from Bill Hansson (Addgene plasmid # 126476 ; http://n2t.net/addgene:126476 ; RRID:Addgene_126476)
  • For your References section:

    Optimization of Insect Odorant Receptor Trafficking and Functional Expression Via Transient Transfection in HEK293 Cells. Miazzi F, Hoyer C, Sachse S, Knaden M, Wicher D, Hansson BS, Lavista-Llanos S. Chem Senses. 2019 Oct 26;44(9):673-682. doi: 10.1093/chemse/bjz062. 10.1093/chemse/bjz062 PubMed 31504297