pET30b_OmpAT7Sav
(Plasmid #138589)

• Purpose: T7-tagged streptavidin with native C-terminus and periplasmic export signal OmpA; controlled by PT7 promoter; KanR, pBR322 ori
• Depositing Lab: Markus Jeschek
• Publication: Jeschek et al Nature. 2016 Sep 29;537(7622):661-665. doi: 10.1038/nature19114. Epub 2016 Aug 29.

Backbone

• Vector backbone: pET30b
• Backbone manufacturer: Novagen
• Total vector size (bp): 5821
• Vector type: Bacterial Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Glucose can be added to growth media to suppress leaky expression
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: T7-tagged streptavidin variant with native C-terminus and OmpA signal peptide for periplasmic export
• Alt name: OmpAT7SAV
• Species: Synthetic
• Insert Size (bp): 537
• Promoter: PT7
• Tags / Fusion Proteins:
  • OmpA export signal (N terminal on insert)
  • T7 tag (N terminal on insert)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: ATGCGTCCGGCGTAGA
• 3′ sequencing primer: TGCTAGTTATTGCTCAGCGG

Resource Information

• Supplemental Documents:
  • pET30bOmpAT7Sav.gb
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry