Modified Shipping Schedule: Addgene will be closed November 26th & 27th for the Thanksgiving holiday. Order processing and shipping may be delayed the week of Nov 23 - 27. If you have any questions, please contact us at

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at Learn more

pIS47 C20orf139 3'UTR
(Plasmid #14489)

Add to Cart
Available to Academic and Nonprofits Only


  • Vector backbone
  • Backbone manufacturer
    Bartel Lab
  • Backbone size w/o insert (bp) 4085
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy

Sequence Information

Full plasmid sequence is available only if provided by the depositing laboratory.


  • Gene/Insert name
    C20orf139 3'UTR
  • Alt name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Entrez Gene
    SRXN1 (a.k.a. Npn3, SRX1, YKL086W, FLJ43353, C20orf139, dJ850E9.2)
  • Tag / Fusion Protein
    • luciferase (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SacI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer Rluc-F (5'-ccaggattcttttccaatgc-3')
  • 3′ sequencing primer EBV rev primer (GTGGTTTGTCCAAACTCATC)
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

C20orf139 3'UTR in renilla luciferase reporter plasmid.

How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pIS47 C20orf139 3'UTR was a gift from David Bartel (Addgene plasmid # 14489)
  • For your References section:

    Microarray analysis shows that some microRNAs downregulate large numbers of target mRNAs. Lim LP, Lau NC, Garrett-Engele P, Grimson A, Schelter JM, Castle J, Bartel DP, Linsley PS, Johnson JM. Nature. 2005 Feb 17. 433(7027):769-73. 10.1038/nature03315 PubMed 15685193