1
Plasmid 14489: pIS47 C20orf139 3'UTR
  • C20orf139 3'UTR

  • C20orf139

  • 520

  • H. sapiens (human)

  • SRXN1 (Npn3, SRX1, YKL086W, FLJ43353, C20orf139, dJ850E9.2)

  • luciferase

  • N terminal on backbone

  • pIS1
    (Search Vector Database)

  • Bartel Lab

  • Mammalian Expression, Luciferase

  • 4085

  • SacI

  • No

  • XbaI

  • No

  • Rluc-F (5'-ccaggattcttttccaatgc-3') List of Sequencing Primers

  • EBV rev primer (GTGGTTTGTCCAAACTCATC)

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • View sequences (2)
  • David Bartel

  • UBMTA
    Luciferase Limited Use Label License

Comments: 

C20orf139 3'UTR in renilla luciferase reporter plasmid.

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Microarray analysis shows that some microRNAs downregulate large numbers of target mRNAs. Lim et al (Nature. 2005 Feb 17. 433(7027):769-73. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 14489" in your Materials and Methods section.

Price: US $65

Available to academic and non-profits only
This is commonly requested with
26114: pRK-ATF4
38086: pFRT/TO/HIS/FLAG/HA-PRDX1