Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

HDM_SARS2_Spike_del21_D614G
(Plasmid #158762)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 158762 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    HDM
  • Backbone size w/o insert (bp) 4552
  • Total vector size (bp) 8314
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SARS2-Spike_del21_D614G
  • Alt name
    Spike
  • Species
    Synthetic; Severe acute respiratory syndrome coronavirus 2
  • Insert Size (bp)
    3672
  • Mutation
    deleted amino acids 1257-1278, changed aspartic acid at position 614 to glycine
  • Entrez Gene
    S (a.k.a. GU280_gp02, spike glycoprotein)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (unknown if destroyed)
  • 3′ cloning site HindIII (unknown if destroyed)
  • 5′ sequencing primer ggcccttttgctaatcatgttcatacctcttatct
  • 3′ sequencing primer ttaaatgcactgacctcccacattc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    HDM_SARS2_Spike_del21_D614G was a gift from Jesse Bloom (Addgene plasmid # 158762 ; http://n2t.net/addgene:158762 ; RRID:Addgene_158762)
  • For your References section:

    Protocol and Reagents for Pseudotyping Lentiviral Particles with SARS-CoV-2 Spike Protein for Neutralization Assays. Crawford KHD, Eguia R, Dingens AS, Loes AN, Malone KD, Wolf CR, Chu HY, Tortorici MA, Veesler D, Murphy M, Pettie D, King NP, Balazs AB, Bloom JD. Viruses. 2020 May 6;12(5). pii: v12050513. doi: 10.3390/v12050513. 10.3390/v12050513 PubMed 32384820