Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

HDM-SARS2-Spike-delta21
(Plasmid #155130)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 155130 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    HDM
  • Backbone size w/o insert (bp) 4750
  • Total vector size (bp) 8314
  • Modifications to backbone
    CGCCACC added 3' to EcoRI site and 5' to S start codon
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SARS-CoV-2 Spike-delta21
  • Alt name
    Codon optimized SARS-CoV-2 Spike
  • Species
    Severe acute respiratory syndrome coronavirus 2
  • Insert Size (bp)
    3762
  • Mutation
    Codon optimized to H. sapiens using IDT codon optimization tool; deleted 21 amino acids by deletion from 3769-3831
  • GenBank ID
    43740568
  • Entrez Gene
    S (a.k.a. GU280_gp02, spike glycoprotein)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer CGCATGGTGTGGTCTTTCTCC
  • 3′ sequencing primer agtccaagctaggcccttttg
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Based on a plasmid described previously in Crawford et al. 2020, Protocol and Reagents for Pseudotyping Lentiviral Particles with SARS-CoV-2 Spike Protein for Neutralization Assays (https://www.mdpi.com/1999-4915/12/5/513). This is a version of the Spike expression plasmid used to pseudotype lentivirus which provided better titers in this protocol.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    HDM-SARS2-Spike-delta21 was a gift from Jesse Bloom (Addgene plasmid # 155130 ; http://n2t.net/addgene:155130 ; RRID:Addgene_155130)