This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #16501)

Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 16501 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 5010
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
    Mad-binding element from Vg
  • Tag / Fusion Protein
    • luciferase (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (unknown if destroyed)
  • 3′ cloning site KpnI (unknown if destroyed)
  • 5′ sequencing primer n/a
  • 3′ sequencing primer LucNrev
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Four copies of the Mad-binding element from Vg (GCTTGGACTGCCGTCGCGATTC) are cloned into pGL3.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Vg4-Luc was a gift from Bert Vogelstein (Addgene plasmid # 16501 ; ; RRID:Addgene_16501)
  • For your References section:

    Human Smad3 and Smad4 are sequence-specific transcription activators. Zawel L, Dai JL, Buckhaults P, Zhou S, Kinzler KW, Vogelstein B, Kern SE. Mol Cell. 1998 Mar . 1(4):611-7. 10.1016/S1097-2765(00)80061-1 PubMed 9660945