Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAAV.hSyn.FLEX.iGluSnFR3.v857.SGZ.codonopt
(Plasmid #175182)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 175182 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV hSyn FLEX
  • Backbone size w/o insert (bp) 4852
  • Total vector size (bp) 6673
  • Vector type
    Mammalian Expression, Mouse Targeting, AAV, Cre/Lox, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    <8 hours
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    pAAV hSyn FLEX iGluSnFR3 v857.SGZ
  • Alt name
    iGluSnFR3 v857.SGZ
  • Alt name
    iGluSnFR3 556dot857.SGZ
  • Alt name
    v857.SGZ
  • Species
    M. musculus (mouse), R. norvegicus (rat), Synthetic
  • Insert Size (bp)
    1821
  • Promoter human Synapsin
  • Tags / Fusion Proteins
    • IgK-chain (N terminal on insert)
    • Myc epi tag (C terminal on insert)
    • Stargazin and PDZ domain (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GAGGAGTCGTGTCGTG
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV.hSyn.FLEX.iGluSnFR3.v857.SGZ.codonopt was a gift from Kaspar Podgorski (Addgene plasmid # 175182 ; http://n2t.net/addgene:175182 ; RRID:Addgene_175182)
  • For your References section:

    Glutamate indicators with improved activation kinetics and localization for imaging synaptic transmission. Aggarwal A, Liu R, Chen Y, Ralowicz AJ, Bergerson SJ, Tomaska F, Mohar B, Hanson TL, Hasseman JP, Reep D, Tsegaye G, Yao P, Ji X, Kloos M, Walpita D, Patel R, Mohr MA, Tillberg PW, Looger LL, Marvin JS, Hoppa MB, Konnerth A, Kleinfeld D, Schreiter ER, Podgorski K. Nat Methods. 2023 May 4. doi: 10.1038/s41592-023-01863-6. 10.1038/s41592-023-01863-6 PubMed 37142767