1
Plasmid 17574: pBPGw
  • GAL4

  • 2646

  • S. cerevisiae (budding yeast)

  • GAL4 (YPL248C, GAL81)

  • pBDP
    (Search Vector Database)

  • Insect Expression

  • 8902

  • KpnI

  • No

  • NotI

  • No

  • BDP F (bp 11,503): AAATAGGGGTTCCGCGCACAT List of Sequencing Primers

  • BDP R (bp 5,286) : ATAATGGTGCAGGGCGCTGAC

  • Ampicillin and Chloramphenicol

  • DB3.1

  • 37

  • Bacterial Strain DB3.1 (Invitrogen) or similar must be used to propagate plasmids carrying the ccdB gene.

  • High Copy

  • GAL4 leader, CDS, and hsp70 polyA were cloned from pGaTB (via DGRC).

  • View sequences (2)
  • View map

  • View map

  • Gerald Rubin

  • UBMTA

Comments: 

pBPGw is a modular Gateway compatible promoter-less GAL4 vector amenable to high throughput in vitro cloning using Invitrogen LR clonase and specific in vivo genomic targeting using PhiC31 integrase. In addition the GAL4 CDS and yeast transcriptional terminator can easily be substituted for another driver by a directional 5' KpnI to 3' HindIII digest.

Addgene has sequenced a portion of this plasmid for verification. Full plasmid sequence is available only if provided by the depositing laboratory.

Article: Tools for Neuroanatomy and Neurogenetics in Drosophila Pfeiffer et al (Tools for neuroanatomy and neurogenetics in Drosophila PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 17574" in your Materials and Methods section.

Price: US $65

Available to academic and non-profits only