pAAV-hSyn-hPOMC1-26-sbGLuc-P2A-dTomato
(Plasmid #176704)

• Purpose: neural activity dependent release of sbGLuc from presynaptic vesicles
• Depositing Lab: Ute Hochgeschwender
• Publication: Prakash et al Commun Biol. 2022 Jan 11;5(1):33. doi: 10.1038/s42003-021-02981-7.

Backbone

• Vector backbone: pAAV
• Backbone size w/o insert (bp): 4530
• Total vector size (bp): 5980
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: Gaussia luciferase, slow burn
• Alt name: sbGLuc
• Promoter: hSyn
• Tag / Fusion Protein:
  • hPOMC1-26 (N terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: AbsI (not destroyed)
• 5′ sequencing primer: ACTGAAGGCGCGCTGACGTCACT
• 3′ sequencing primer: CATAGCGTAAAAGGAGCAACA

Gene/Insert 2

• Gene/Insert name: dTomato
• Insert Size (bp): 702
• Promoter: hSyn
• Tag / Fusion Protein:
  • P2A (N terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: AbsI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: atggtgagcaagggcgag
• 3′ sequencing primer: CATAGCGTAAAAGGAGCAACA

Resource Information

• Supplemental Documents:
  • pAAV hSyn hPOMC1-26-sbGluc-P2A-dTomato.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://doi.org/10.1101/2021.10.29.466531 for bioRxiv preprint.