pLX_305_Ovalbumin
(Plasmid
#184924)
-
PurposeLentiviral vector for expressing Ovalbumin. Also expresses the puromycin resistance gene as a selectable marker.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 184924 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLX_305
-
Backbone manufacturerBroad Institute Genetic Perturbation Platform
- Backbone size w/o insert (bp) 7555
- Total vector size (bp) 8716
-
Modifications to backboneCloned in Ovalbumin after the PGK promoter.
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameOvalbumin
-
SpeciesG. gallus (chicken)
-
Insert Size (bp)1161
-
MutationOur vector has an A188T mutation that does not impact SIINFEKL presentation or responses.
-
GenBank ID396058
-
Entrez GeneOVAL (a.k.a. OVA, SERPINB14)
- Promoter PGK
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site AgeI (not destroyed)
- 5′ sequencing primer TAAGTCGGGAAGGTTCCTTGCG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLX_305_Ovalbumin was a gift from Arlene Sharpe (Addgene plasmid # 184924 ; http://n2t.net/addgene:184924 ; RRID:Addgene_184924) -
For your References section:
Framework for in vivo T cell screens. Milling LE, Markson SC, Tjokrosurjo Q, Derosia NM, Streeter ISL, Hickok GH, Lemmen AM, Nguyen TH, Prathima P, Fithian W, Schwartz MA, Hacohen N, Doench JG, LaFleur MW, Sharpe AH. J Exp Med. 2024 Apr 1;221(4):e20230699. doi: 10.1084/jem.20230699. Epub 2024 Feb 27. 10.1084/jem.20230699 PubMed 38411617