1
Plasmid 18879: pmAmetrine-DEVD-tdTomato
  • mAmetrine-DEVD-tdTomato

  • caspase-3 sensor

  • 2100

  • H. sapiens (human)

  • lab constructed

  • mAmetrine-tdTomato linker sequence: ...ITLGGTGSGSGDEVDGMVSKGEEVIK...; Backbone NLS tag has been removed when digested with BamH1

  • pEYFP-Nuc
    (Search Vector Database)

  • Clonetech

  • Mammalian Expression

  • 4000

  • Nhe1

  • No

  • BamH1

  • No

  • CGTCGCCGTCCAGCTCGACCAG List of Sequencing Primers

  • CATGGTCCTGCTGGAGTTCGTG

  • Kanamycin

  • DH5alpha

  • 37

  • High Copy

  • Neomycin

  • View sequences (3)
  • Robert Campbell

  • MTA
    Clontech Limited Use Label License

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Fluorescent protein FRET pairs for ratiometric imaging of dual biosensors. Ai et al (Nat Methods. 2008 May . 5(5):401-3. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 18879" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only