1
Plasmid 19771: pCX-OKS-2A
  • Oct3/4-2A-Klf4-2A-Sox2

  • Pou5f1

  • Sox2

  • Klf4

  • 3700

  • M. musculus (mouse)

  • Sox2 (AL606746.1, Sox-2, lcc, ysb)
    Klf4 (RP23-322L22.2, EZF, Gklf, Zie)
    Pou5f1 (NF-A3, Oct-3, Oct-3/4, Oct-4, Oct3, Oct3/4, Oct4, Otf-3, Otf-4, Otf3, Otf3-rs7, Otf3g, Otf4)

  • Three genes are connected with the foot-and-mouth disease virus 2A self-cleaving sequence.

  • pCX
    (Search Vector Database)

  • Jun-ichi Miyazaki

  • Mammalian Expression

  • 4778

  • EcoRI

  • No

  • EcoRI

  • No

  • GCGAGCCGCAGCCATTGCCTTTTA List of Sequencing Primers

  • TTAGCCAGAAGTCAGATGCTC

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • CAG Promoter was from Dr. Jun-ichi Miyazaki of Osaka University Graduate School of Medicine. In publication using this plasmid, please cite: Efficient selection for high-expression transfectants with a novel eukaryotic vector. Gene 108:193-200, 1991. Niwa, H., Yamamura, K. & Miyazaki, J.

  • View sequences (5)
  • View map

  • Yamanaka gel (application/pdf)

  • Notes from Addgene (1)

  • Shinya Yamanaka

  • MTA

Comments: 

Addgene has verified the insert size with an EcoRI digest. To see a picture of the digest, click on "Reviews" under Plasmid Links, to the right of this page.

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Generation of Mouse Induced Pluripotent Stem Cells Without Viral Vectors. Okita et al (Science. 2008 Oct 9. ():. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 19771" in your Materials and Methods section.