1
Plasmid 19772: pCX-cMyc
  • c-Myc

  • 1350

  • M. musculus (mouse)

  • Myc (AU016757, Myc2, Niard, Nird, bHLHe39)

  • pCX
    (Search Vector Database)

  • Jun-ichi Miyazaki

  • Mammalian Expression

  • 4778

  • EcoRI

  • No

  • EcoRI

  • No

  • GCGAGCCGCAGCCATTGCCTTTTA List of Sequencing Primers

  • TTAGCCAGAAGTCAGATGCTC

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • CAG Promoter was from Dr. Jun-ichi Miyazaki of Osaka University Graduate School of Medicine. In publication using this plasmid, please cite: Efficient selection for high-expression transfectants with a novel eukaryotic vector. Gene 108:193-200, 1991. Niwa, H., Yamamura, K. & Miyazaki, J.

  • View sequences (3)
  • Shinya Yamanaka

  • MTA

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Generation of Mouse Induced Pluripotent Stem Cells Without Viral Vectors. Okita et al (Science. 2008 Oct 9. ():. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 19772" in your Materials and Methods section.