Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

TetO-FUW-oct4
(Plasmid #20323)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 20323 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    FUW
  • Backbone manufacturer
    homemade
  • Backbone size w/o insert (bp) 8376
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Growth instructions
    TOP10, 37C
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    oct4
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1316
  • Entrez Gene
    Pou5f1 (a.k.a. NF-A3, Oct-3, Oct-3/4, Oct-4, Oct3, Oct3/4, Oct4, Otf-3, Otf-4, Otf3, Otf3-rs7, Otf3g, Otf4)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer AAGACCACCGCACAGCAAGC
  • 3′ sequencing primer TTCCGCCGTGGCAATAGGGA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    TetO-FUW-oct4 was a gift from Rudolf Jaenisch (Addgene plasmid # 20323 ; http://n2t.net/addgene:20323 ; RRID:Addgene_20323)
  • For your References section:

    Sequential expression of pluripotency markers during direct reprogramming of mouse somatic cells. Brambrink T, Foreman R, Welstead GG, Lengner CJ, Wernig M, Suh H, Jaenisch R. Cell Stem Cell. 2008 Feb 7. 2(2):151-9. 10.1016/j.stem.2008.01.004 PubMed 18371436