-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 20323 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneFUW
-
Backbone manufacturerhomemade
- Backbone size w/o insert (bp) 8376
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Growth instructionsTOP10, 37C
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameoct4
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1316
-
Entrez GenePou5f1 (a.k.a. NF-A3, Oct-3, Oct-3/4, Oct-4, Oct3, Oct3/4, Oct4, Otf-3, Otf-4, Otf3, Otf3-rs7, Otf3g, Otf4)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer AAGACCACCGCACAGCAAGC
- 3′ sequencing primer TTCCGCCGTGGCAATAGGGA (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TetO-FUW-oct4 was a gift from Rudolf Jaenisch (Addgene plasmid # 20323 ; http://n2t.net/addgene:20323 ; RRID:Addgene_20323) -
For your References section:
Sequential expression of pluripotency markers during direct reprogramming of mouse somatic cells. Brambrink T, Foreman R, Welstead GG, Lengner CJ, Wernig M, Suh H, Jaenisch R. Cell Stem Cell. 2008 Feb 7. 2(2):151-9. 10.1016/j.stem.2008.01.004 PubMed 18371436