-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 20733 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepBS
- Backbone size w/o insert (bp) 3176
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFlpE recombinase
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)1416
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRV (not destroyed)
- 3′ cloning site SphI (not destroyed)
- 5′ sequencing primer TTCGGCTTCTGGCGTGTGAC
- 3′ sequencing primer M13R (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that this plasmid runs as a multimer. Plasmid multimerization often does not impact plasmid function, but may reduce transformation efficiencies. If you need the monomeric version, you might consider linearizing, gel extracting, re-ligating, and transforming the plasmid.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAGGS-flpE-puro was a gift from Rudolf Jaenisch (Addgene plasmid # 20733 ; http://n2t.net/addgene:20733 ; RRID:Addgene_20733) -
For your References section:
Efficient method to generate single-copy transgenic mice by site-specific integration in embryonic stem cells. Beard C, Hochedlinger K, Plath K, Wutz A, Jaenisch R. Genesis. 2006 Jan . 44(1):23-8. 10.1002/gene.20180 PubMed 16400644