This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #20882)


Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 20882 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 5256
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    Lats2 3'UTR
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
  • GenBank ID

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer GGAAAACTCGACGCAAGA
  • 3′ sequencing primer CACATTTGTAGAGGTTTTACTTGCT
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

A C->T mutation at nt530 in Addgene's sequence should not affect the function of this plasmid.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGL-Lats2UTR was a gift from Robert Blelloch (Addgene plasmid # 20882 ; ; RRID:Addgene_20882)
  • For your References section:

    Embryonic stem cell-specific microRNAs regulate the G1-S transition and promote rapid proliferation. Wang Y, Baskerville S, Shenoy A, Babiarz JE, Baehner L, Blelloch R. Nat Genet. 2008 Dec . 40(12):1478-83. 10.1038/ng.250 PubMed 18978791