1
Plasmid 21110: pBABE-puro-mouse Oct4
  • Oct4

  • Pou5f1

  • 1059

  • M. musculus (mouse)

  • Pou5f1 (NF-A3, Oct-3, Oct-3/4, Oct-4, Oct3, Oct3/4, Oct4, Otf-3, Otf-4, Otf3, Otf3-rs7, Otf3g, Otf4)

  • pBABE-puro
    (Search Vector Database)

  • Mammalian Expression, Retroviral

  • 5169

  • EcoR1

  • No

  • EcoR1

  • No

  • gcctcaatcctccctttatcc List of Sequencing Primers

  • Ampicillin

  • DH5alpha

  • 37

  • Unknown

  • Puromycin

  • View sequences (1)
  • Dean Tantin

  • MTA

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: A general mechanism for transcription regulation by Oct1 and Oct4 in response to genotoxic and oxidative stress. Kang et al (Genes Dev. 2009 Jan 15. 23(2):208-22. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 21110" in your Materials and Methods section.