pCMV4 p65
(Plasmid #21966)

• Depositing Lab: Warner Greene
• Publication: Ballard et al Proc Natl Acad Sci U S A. 1992 Mar 1. 89(5):1875-9.

Backbone

• Vector backbone: pCMV4
• Backbone manufacturer: Andersson,S. et al, J. Biol. Chem. 264 (14), 8222-8229 (1989)
• Backbone size w/o insert (bp): 4874
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: NFkB p65 subunit
• Alt name: RelA
• Species: H. sapiens (human)
• Insert Size (bp): 2500
• Mutation: This construct was the product of 3 subcloning procedures: 1. XbaI-EcoRI-p65-EcoRI-KpnI from pBluescript II SK +/- was digested with XbaI/KpnI, and subcloned to M13 mp19. 2. HindIII-XbaI-p65-HindIII-KpnI from the M13 mp19 construct was digested with HindIII, then subcloned into pCMV4. 3. The resulting pCMV4 p65 plasmid can be liberated using HindIII, with a size of ~2.5 kb. The large size (p65 is only 1.5kb) is due to the inclusion of multiple polylinkers from pBluescript and M13mp19 as well as non-coding regions of p65.
• Entrez Gene: RELA (a.k.a. AIF3BL3, CMCU, NFKB3, p65)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: CMV forward: cgcaaatgggcggtaggcgtg

Resource Information

• Articles Citing this Plasmid:
  • 37 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry