Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at Learn more

pCMV4 p65
(Plasmid #21966)


Item Catalog # Description Quantity Price (USD)
Plasmid 21966 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Andersson,S. et al, J. Biol. Chem. 264 (14), 8222-8229 (1989)
  • Backbone size w/o insert (bp) 4874
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    Low Copy


  • Gene/Insert name
    NFkB p65 subunit
  • Alt name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Mutation
    This construct was the product of 3 subcloning procedures: 1. XbaI-EcoRI-p65-EcoRI-KpnI from pBluescript II SK +/- was digested with XbaI/KpnI, and subcloned to M13 mp19. 2. HindIII-XbaI-p65-HindIII-KpnI from the M13 mp19 construct was digested with HindIII, then subcloned into pCMV4. 3. The resulting pCMV4 p65 plasmid can be liberated using HindIII, with a size of ~2.5 kb. The large size (p65 is only 1.5kb) is due to the inclusion of multiple polylinkers from pBluescript and M13mp19 as well as non-coding regions of p65.
  • Entrez Gene
    RELA (a.k.a. NFKB3, p65)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer CMV forward: cgcaaatgggcggtaggcgtg
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV4 p65 was a gift from Warner Greene (Addgene plasmid # 21966)
  • For your References section:

    The 65-kDa subunit of human NF-kappa B functions as a potent transcriptional activator and a target for v-Rel-mediated repression. Ballard DW, Dixon EP, Peffer NJ, Bogerd H, Doerre S, Stein B, Greene WC. Proc Natl Acad Sci U S A. 1992 Mar 1. 89(5):1875-9. 10.1073/pnas.89.5.1875 PubMed 1542686