Plasmid 21966: pCMV4 p65
  • NFkB p65 subunit

  • RelA

  • 2500

  • H. sapiens (human)

  • RELA (NFKB3, p65)

  • This construct was the product of 3 subcloning procedures: 1. XbaI-EcoRI-p65-EcoRI-KpnI from pBluescript II SK +/- was digested with XbaI/KpnI, and subcloned to M13 mp19. 2. HindIII-XbaI-p65-HindIII-KpnI from the M13 mp19 construct was digested with HindIII, then subcloned into pCMV4. 3. The resulting pCMV4 p65 plasmid can be liberated using HindIII, with a size of ~2.5 kb. The large size (p65 is only 1.5kb) is due to the inclusion of multiple polylinkers from pBluescript and M13mp19 as well as non-coding regions of p65.

  • pCMV4
    (Search Vector Database)

  • Andersson,S. et al, J. Biol. Chem. 264 (14), 8222-8229 (1989)

  • Mammalian Expression

  • 4874

  • HindIII

  • No

  • HindIII

  • No

  • CMV forward: cgcaaatgggcggtaggcgtg List of Sequencing Primers

  • Ampicillin

  • DH5alpha

  • 37

  • Low Copy

  • View sequences (2)
  • Warner Greene


Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: The 65-kDa subunit of human NF-kappa B functions as a potent transcriptional activator and a target for v-Rel-mediated repression. Ballard et al (Proc Natl Acad Sci U S A. 1992 Mar 1. 89(5):1875-9. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 21966" in your Materials and Methods section.