1
Plasmid Cart
Login to add to cart
Recently Visited
Plasmid 22039: pRRL_H1shmp53_PGK_eGFP_Teto
  • shmp53

  • 57

  • pRRL.SIN.cPPT.PGK.GFP
    (Search Vector Database)

  • Lentiviral

  • 7600

  • n/a List of Sequencing Primers

  • Ampicillin

  • Stbl3

  • 37

  • HB101

  • Low Copy

  • View sequences (2)
  • Didier Trono

  • MTA

Comments: 

shmp53 oligo sequence is: 5'-aaaaacactacaagtacatgtgtatttctcttgatacacatgtacttgtagtg

Please note that this plasmid is not hazardous to humans by itself, but virus made from the plasmid should be treated carefully. The shRNA it produces is against mouse p53 and the targeted sequence does not match with the human sequence. However since the degradation of human p53 would potentially have oncogenic consequences, viral stocks should be manipulated carefully.

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 22039" in your Materials and Methods section.